ID: 1074248060

View in Genome Browser
Species Human (GRCh38)
Location 10:111714213-111714235
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074248051_1074248060 13 Left 1074248051 10:111714177-111714199 CCCAAGAGTGCAGAGAGATGACT No data
Right 1074248060 10:111714213-111714235 CAGCTGCACCCAGGAGGGCAGGG No data
1074248049_1074248060 15 Left 1074248049 10:111714175-111714197 CCCCCAAGAGTGCAGAGAGATGA No data
Right 1074248060 10:111714213-111714235 CAGCTGCACCCAGGAGGGCAGGG No data
1074248046_1074248060 25 Left 1074248046 10:111714165-111714187 CCTTCCCAAGCCCCCAAGAGTGC No data
Right 1074248060 10:111714213-111714235 CAGCTGCACCCAGGAGGGCAGGG No data
1074248048_1074248060 20 Left 1074248048 10:111714170-111714192 CCAAGCCCCCAAGAGTGCAGAGA No data
Right 1074248060 10:111714213-111714235 CAGCTGCACCCAGGAGGGCAGGG No data
1074248050_1074248060 14 Left 1074248050 10:111714176-111714198 CCCCAAGAGTGCAGAGAGATGAC No data
Right 1074248060 10:111714213-111714235 CAGCTGCACCCAGGAGGGCAGGG No data
1074248047_1074248060 21 Left 1074248047 10:111714169-111714191 CCCAAGCCCCCAAGAGTGCAGAG No data
Right 1074248060 10:111714213-111714235 CAGCTGCACCCAGGAGGGCAGGG No data
1074248052_1074248060 12 Left 1074248052 10:111714178-111714200 CCAAGAGTGCAGAGAGATGACTG No data
Right 1074248060 10:111714213-111714235 CAGCTGCACCCAGGAGGGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074248060 Original CRISPR CAGCTGCACCCAGGAGGGCA GGG Intergenic