ID: 1074249087

View in Genome Browser
Species Human (GRCh38)
Location 10:111725703-111725725
Sequence ACCACAGCACGTTCCTGGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074249083_1074249087 3 Left 1074249083 10:111725677-111725699 CCACCGAGGACATGGGCACAAAT No data
Right 1074249087 10:111725703-111725725 ACCACAGCACGTTCCTGGAGTGG No data
1074249085_1074249087 0 Left 1074249085 10:111725680-111725702 CCGAGGACATGGGCACAAATGGC No data
Right 1074249087 10:111725703-111725725 ACCACAGCACGTTCCTGGAGTGG No data
1074249080_1074249087 14 Left 1074249080 10:111725666-111725688 CCTAAACAGGTCCACCGAGGACA No data
Right 1074249087 10:111725703-111725725 ACCACAGCACGTTCCTGGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074249087 Original CRISPR ACCACAGCACGTTCCTGGAG TGG Intergenic
No off target data available for this crispr