ID: 1074252029

View in Genome Browser
Species Human (GRCh38)
Location 10:111760677-111760699
Sequence TGTACATGGCTCACTGGAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074252029_1074252038 29 Left 1074252029 10:111760677-111760699 CCCATTCCAGTGAGCCATGTACA No data
Right 1074252038 10:111760729-111760751 ACTCTGTCCTCCAGGAAGCTTGG No data
1074252029_1074252037 21 Left 1074252029 10:111760677-111760699 CCCATTCCAGTGAGCCATGTACA No data
Right 1074252037 10:111760721-111760743 TGAGTTTCACTCTGTCCTCCAGG No data
1074252029_1074252039 30 Left 1074252029 10:111760677-111760699 CCCATTCCAGTGAGCCATGTACA No data
Right 1074252039 10:111760730-111760752 CTCTGTCCTCCAGGAAGCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074252029 Original CRISPR TGTACATGGCTCACTGGAAT GGG (reversed) Intergenic
No off target data available for this crispr