ID: 1074261911

View in Genome Browser
Species Human (GRCh38)
Location 10:111862580-111862602
Sequence TCCTTTGCATATCCCAAGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074261911_1074261915 11 Left 1074261911 10:111862580-111862602 CCAGACTTGGGATATGCAAAGGA No data
Right 1074261915 10:111862614-111862636 TGCTGCCTTGGCTAAGGGTGTGG No data
1074261911_1074261914 6 Left 1074261911 10:111862580-111862602 CCAGACTTGGGATATGCAAAGGA No data
Right 1074261914 10:111862609-111862631 GCATCTGCTGCCTTGGCTAAGGG No data
1074261911_1074261913 5 Left 1074261911 10:111862580-111862602 CCAGACTTGGGATATGCAAAGGA No data
Right 1074261913 10:111862608-111862630 TGCATCTGCTGCCTTGGCTAAGG No data
1074261911_1074261912 -1 Left 1074261911 10:111862580-111862602 CCAGACTTGGGATATGCAAAGGA No data
Right 1074261912 10:111862602-111862624 AGATGTTGCATCTGCTGCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074261911 Original CRISPR TCCTTTGCATATCCCAAGTC TGG (reversed) Intergenic
No off target data available for this crispr