ID: 1074261939

View in Genome Browser
Species Human (GRCh38)
Location 10:111862957-111862979
Sequence TTGCCCTGACCTATATCCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074261936_1074261939 13 Left 1074261936 10:111862921-111862943 CCCATTTTACAGTTGAGGAGACA No data
Right 1074261939 10:111862957-111862979 TTGCCCTGACCTATATCCCATGG No data
1074261937_1074261939 12 Left 1074261937 10:111862922-111862944 CCATTTTACAGTTGAGGAGACAT No data
Right 1074261939 10:111862957-111862979 TTGCCCTGACCTATATCCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074261939 Original CRISPR TTGCCCTGACCTATATCCCA TGG Intergenic
No off target data available for this crispr