ID: 1074263872

View in Genome Browser
Species Human (GRCh38)
Location 10:111881738-111881760
Sequence ATAGAGAAGTGGGCTGGGGA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074263860_1074263872 19 Left 1074263860 10:111881696-111881718 CCTTCTATTTGGCGGAAATAACA No data
Right 1074263872 10:111881738-111881760 ATAGAGAAGTGGGCTGGGGACGG No data
1074263865_1074263872 -9 Left 1074263865 10:111881724-111881746 CCAGCCTGGGTGGTATAGAGAAG No data
Right 1074263872 10:111881738-111881760 ATAGAGAAGTGGGCTGGGGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074263872 Original CRISPR ATAGAGAAGTGGGCTGGGGA CGG Intergenic
No off target data available for this crispr