ID: 1074264105

View in Genome Browser
Species Human (GRCh38)
Location 10:111883808-111883830
Sequence TGGACTTAAGGCCTAGGGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074264105_1074264115 17 Left 1074264105 10:111883808-111883830 CCAAGCCCTAGGCCTTAAGTCCA No data
Right 1074264115 10:111883848-111883870 TAGCATGGCCAGTGTAAGCACGG No data
1074264105_1074264112 2 Left 1074264105 10:111883808-111883830 CCAAGCCCTAGGCCTTAAGTCCA No data
Right 1074264112 10:111883833-111883855 GAACCCACATTCATTTAGCATGG No data
1074264105_1074264116 23 Left 1074264105 10:111883808-111883830 CCAAGCCCTAGGCCTTAAGTCCA No data
Right 1074264116 10:111883854-111883876 GGCCAGTGTAAGCACGGTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074264105 Original CRISPR TGGACTTAAGGCCTAGGGCT TGG (reversed) Intergenic
No off target data available for this crispr