ID: 1074264108

View in Genome Browser
Species Human (GRCh38)
Location 10:111883813-111883835
Sequence TTCCCTGGACTTAAGGCCTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074264108_1074264112 -3 Left 1074264108 10:111883813-111883835 CCCTAGGCCTTAAGTCCAGGGAA No data
Right 1074264112 10:111883833-111883855 GAACCCACATTCATTTAGCATGG No data
1074264108_1074264116 18 Left 1074264108 10:111883813-111883835 CCCTAGGCCTTAAGTCCAGGGAA No data
Right 1074264116 10:111883854-111883876 GGCCAGTGTAAGCACGGTCAAGG No data
1074264108_1074264115 12 Left 1074264108 10:111883813-111883835 CCCTAGGCCTTAAGTCCAGGGAA No data
Right 1074264115 10:111883848-111883870 TAGCATGGCCAGTGTAAGCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074264108 Original CRISPR TTCCCTGGACTTAAGGCCTA GGG (reversed) Intergenic
No off target data available for this crispr