ID: 1074264110

View in Genome Browser
Species Human (GRCh38)
Location 10:111883820-111883842
Sequence ATGTGGGTTCCCTGGACTTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074264110_1074264112 -10 Left 1074264110 10:111883820-111883842 CCTTAAGTCCAGGGAACCCACAT No data
Right 1074264112 10:111883833-111883855 GAACCCACATTCATTTAGCATGG No data
1074264110_1074264115 5 Left 1074264110 10:111883820-111883842 CCTTAAGTCCAGGGAACCCACAT No data
Right 1074264115 10:111883848-111883870 TAGCATGGCCAGTGTAAGCACGG No data
1074264110_1074264116 11 Left 1074264110 10:111883820-111883842 CCTTAAGTCCAGGGAACCCACAT No data
Right 1074264116 10:111883854-111883876 GGCCAGTGTAAGCACGGTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074264110 Original CRISPR ATGTGGGTTCCCTGGACTTA AGG (reversed) Intergenic
No off target data available for this crispr