ID: 1074264112

View in Genome Browser
Species Human (GRCh38)
Location 10:111883833-111883855
Sequence GAACCCACATTCATTTAGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074264108_1074264112 -3 Left 1074264108 10:111883813-111883835 CCCTAGGCCTTAAGTCCAGGGAA No data
Right 1074264112 10:111883833-111883855 GAACCCACATTCATTTAGCATGG No data
1074264104_1074264112 3 Left 1074264104 10:111883807-111883829 CCCAAGCCCTAGGCCTTAAGTCC No data
Right 1074264112 10:111883833-111883855 GAACCCACATTCATTTAGCATGG No data
1074264105_1074264112 2 Left 1074264105 10:111883808-111883830 CCAAGCCCTAGGCCTTAAGTCCA No data
Right 1074264112 10:111883833-111883855 GAACCCACATTCATTTAGCATGG No data
1074264102_1074264112 26 Left 1074264102 10:111883784-111883806 CCACTTCATCTGCTCAAAGTATT No data
Right 1074264112 10:111883833-111883855 GAACCCACATTCATTTAGCATGG No data
1074264109_1074264112 -4 Left 1074264109 10:111883814-111883836 CCTAGGCCTTAAGTCCAGGGAAC No data
Right 1074264112 10:111883833-111883855 GAACCCACATTCATTTAGCATGG No data
1074264110_1074264112 -10 Left 1074264110 10:111883820-111883842 CCTTAAGTCCAGGGAACCCACAT No data
Right 1074264112 10:111883833-111883855 GAACCCACATTCATTTAGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074264112 Original CRISPR GAACCCACATTCATTTAGCA TGG Intergenic
No off target data available for this crispr