ID: 1074264113

View in Genome Browser
Species Human (GRCh38)
Location 10:111883836-111883858
Sequence TGGCCATGCTAAATGAATGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074264113_1074264116 -5 Left 1074264113 10:111883836-111883858 CCCACATTCATTTAGCATGGCCA No data
Right 1074264116 10:111883854-111883876 GGCCAGTGTAAGCACGGTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074264113 Original CRISPR TGGCCATGCTAAATGAATGT GGG (reversed) Intergenic
No off target data available for this crispr