ID: 1074264116

View in Genome Browser
Species Human (GRCh38)
Location 10:111883854-111883876
Sequence GGCCAGTGTAAGCACGGTCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074264109_1074264116 17 Left 1074264109 10:111883814-111883836 CCTAGGCCTTAAGTCCAGGGAAC No data
Right 1074264116 10:111883854-111883876 GGCCAGTGTAAGCACGGTCAAGG No data
1074264110_1074264116 11 Left 1074264110 10:111883820-111883842 CCTTAAGTCCAGGGAACCCACAT No data
Right 1074264116 10:111883854-111883876 GGCCAGTGTAAGCACGGTCAAGG No data
1074264114_1074264116 -6 Left 1074264114 10:111883837-111883859 CCACATTCATTTAGCATGGCCAG No data
Right 1074264116 10:111883854-111883876 GGCCAGTGTAAGCACGGTCAAGG No data
1074264111_1074264116 3 Left 1074264111 10:111883828-111883850 CCAGGGAACCCACATTCATTTAG No data
Right 1074264116 10:111883854-111883876 GGCCAGTGTAAGCACGGTCAAGG No data
1074264113_1074264116 -5 Left 1074264113 10:111883836-111883858 CCCACATTCATTTAGCATGGCCA No data
Right 1074264116 10:111883854-111883876 GGCCAGTGTAAGCACGGTCAAGG No data
1074264108_1074264116 18 Left 1074264108 10:111883813-111883835 CCCTAGGCCTTAAGTCCAGGGAA No data
Right 1074264116 10:111883854-111883876 GGCCAGTGTAAGCACGGTCAAGG No data
1074264104_1074264116 24 Left 1074264104 10:111883807-111883829 CCCAAGCCCTAGGCCTTAAGTCC No data
Right 1074264116 10:111883854-111883876 GGCCAGTGTAAGCACGGTCAAGG No data
1074264105_1074264116 23 Left 1074264105 10:111883808-111883830 CCAAGCCCTAGGCCTTAAGTCCA No data
Right 1074264116 10:111883854-111883876 GGCCAGTGTAAGCACGGTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074264116 Original CRISPR GGCCAGTGTAAGCACGGTCA AGG Intergenic
No off target data available for this crispr