ID: 1074265553

View in Genome Browser
Species Human (GRCh38)
Location 10:111899548-111899570
Sequence GCTTCTGTGTGAACAGGAAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074265553_1074265555 -1 Left 1074265553 10:111899548-111899570 CCTATTCCTGTTCACACAGAAGC No data
Right 1074265555 10:111899570-111899592 CAATGCAGAATAGAGAAAAAAGG No data
1074265553_1074265556 0 Left 1074265553 10:111899548-111899570 CCTATTCCTGTTCACACAGAAGC No data
Right 1074265556 10:111899571-111899593 AATGCAGAATAGAGAAAAAAGGG No data
1074265553_1074265557 17 Left 1074265553 10:111899548-111899570 CCTATTCCTGTTCACACAGAAGC No data
Right 1074265557 10:111899588-111899610 AAAGGGCTTAACTAGAAGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074265553 Original CRISPR GCTTCTGTGTGAACAGGAAT AGG (reversed) Intergenic
No off target data available for this crispr