ID: 1074265562

View in Genome Browser
Species Human (GRCh38)
Location 10:111899637-111899659
Sequence CACATTTAGCAGTGTGACTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074265559_1074265562 -7 Left 1074265559 10:111899621-111899643 CCAGCCCTGGACTTGTCACATTT No data
Right 1074265562 10:111899637-111899659 CACATTTAGCAGTGTGACTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074265562 Original CRISPR CACATTTAGCAGTGTGACTT TGG Intergenic
No off target data available for this crispr