ID: 1074267760

View in Genome Browser
Species Human (GRCh38)
Location 10:111921628-111921650
Sequence GAAGCAGGAGCTCCACTATT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074267755_1074267760 2 Left 1074267755 10:111921603-111921625 CCACTTCCCTTACACATTAGTGT No data
Right 1074267760 10:111921628-111921650 GAAGCAGGAGCTCCACTATTAGG No data
1074267751_1074267760 23 Left 1074267751 10:111921582-111921604 CCCATAGCAAGTCCGTGGCTCCC No data
Right 1074267760 10:111921628-111921650 GAAGCAGGAGCTCCACTATTAGG No data
1074267754_1074267760 3 Left 1074267754 10:111921602-111921624 CCCACTTCCCTTACACATTAGTG No data
Right 1074267760 10:111921628-111921650 GAAGCAGGAGCTCCACTATTAGG No data
1074267753_1074267760 11 Left 1074267753 10:111921594-111921616 CCGTGGCTCCCACTTCCCTTACA No data
Right 1074267760 10:111921628-111921650 GAAGCAGGAGCTCCACTATTAGG No data
1074267758_1074267760 -5 Left 1074267758 10:111921610-111921632 CCTTACACATTAGTGTTGGAAGC No data
Right 1074267760 10:111921628-111921650 GAAGCAGGAGCTCCACTATTAGG No data
1074267757_1074267760 -4 Left 1074267757 10:111921609-111921631 CCCTTACACATTAGTGTTGGAAG No data
Right 1074267760 10:111921628-111921650 GAAGCAGGAGCTCCACTATTAGG No data
1074267752_1074267760 22 Left 1074267752 10:111921583-111921605 CCATAGCAAGTCCGTGGCTCCCA No data
Right 1074267760 10:111921628-111921650 GAAGCAGGAGCTCCACTATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074267760 Original CRISPR GAAGCAGGAGCTCCACTATT AGG Intergenic
No off target data available for this crispr