ID: 1074272714

View in Genome Browser
Species Human (GRCh38)
Location 10:111971010-111971032
Sequence GGGGAGTTAAGGGGTTTGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074272714_1074272737 26 Left 1074272714 10:111971010-111971032 CCCCTCAAACCCCTTAACTCCCC No data
Right 1074272737 10:111971059-111971081 CCCAAATGCAAATCCAACCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074272714 Original CRISPR GGGGAGTTAAGGGGTTTGAG GGG (reversed) Intergenic
No off target data available for this crispr