ID: 1074275567

View in Genome Browser
Species Human (GRCh38)
Location 10:111998762-111998784
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074275564_1074275567 -10 Left 1074275564 10:111998749-111998771 CCTACTCTGTGAAAGTCATAAAA No data
Right 1074275567 10:111998762-111998784 AGTCATAAAACTGGGTGCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074275567 Original CRISPR AGTCATAAAACTGGGTGCAG TGG Intergenic
No off target data available for this crispr