ID: 1074276845

View in Genome Browser
Species Human (GRCh38)
Location 10:112011585-112011607
Sequence CAGTGTCAGGGGAGGGTGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074276845_1074276863 23 Left 1074276845 10:112011585-112011607 CCATTCACCCTCCCCTGACACTG No data
Right 1074276863 10:112011631-112011653 TAACAGTCTCCCAGTCAGAATGG No data
1074276845_1074276864 24 Left 1074276845 10:112011585-112011607 CCATTCACCCTCCCCTGACACTG No data
Right 1074276864 10:112011632-112011654 AACAGTCTCCCAGTCAGAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074276845 Original CRISPR CAGTGTCAGGGGAGGGTGAA TGG (reversed) Intergenic
No off target data available for this crispr