ID: 1074282097

View in Genome Browser
Species Human (GRCh38)
Location 10:112062363-112062385
Sequence GCTCCTTTTCTATTTAAGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074282095_1074282097 3 Left 1074282095 10:112062337-112062359 CCTTGGCTTTCTGATTTCCAGTG No data
Right 1074282097 10:112062363-112062385 GCTCCTTTTCTATTTAAGACAGG No data
1074282094_1074282097 4 Left 1074282094 10:112062336-112062358 CCCTTGGCTTTCTGATTTCCAGT No data
Right 1074282097 10:112062363-112062385 GCTCCTTTTCTATTTAAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074282097 Original CRISPR GCTCCTTTTCTATTTAAGAC AGG Intergenic
No off target data available for this crispr