ID: 1074283900

View in Genome Browser
Species Human (GRCh38)
Location 10:112079931-112079953
Sequence AAATCATGTATTGCAGCTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074283900_1074283902 6 Left 1074283900 10:112079931-112079953 CCAGTAGCTGCAATACATGATTT No data
Right 1074283902 10:112079960-112079982 TGATTACTTTCCGTCTAATAGGG No data
1074283900_1074283901 5 Left 1074283900 10:112079931-112079953 CCAGTAGCTGCAATACATGATTT No data
Right 1074283901 10:112079959-112079981 TTGATTACTTTCCGTCTAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074283900 Original CRISPR AAATCATGTATTGCAGCTAC TGG (reversed) Intergenic
No off target data available for this crispr