ID: 1074288802

View in Genome Browser
Species Human (GRCh38)
Location 10:112122804-112122826
Sequence GATATGATTTTGATGAAGAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074288802_1074288812 29 Left 1074288802 10:112122804-112122826 CCTATCTTCATCAAAATCATATC No data
Right 1074288812 10:112122856-112122878 TCTAAGGAGGTAGGAAGGCGAGG No data
1074288802_1074288813 30 Left 1074288802 10:112122804-112122826 CCTATCTTCATCAAAATCATATC No data
Right 1074288813 10:112122857-112122879 CTAAGGAGGTAGGAAGGCGAGGG No data
1074288802_1074288809 16 Left 1074288802 10:112122804-112122826 CCTATCTTCATCAAAATCATATC No data
Right 1074288809 10:112122843-112122865 GGGAAAAGCTGTGTCTAAGGAGG No data
1074288802_1074288807 -4 Left 1074288802 10:112122804-112122826 CCTATCTTCATCAAAATCATATC No data
Right 1074288807 10:112122823-112122845 TATCAAAAGAGAAGTGGAGGGGG No data
1074288802_1074288803 -10 Left 1074288802 10:112122804-112122826 CCTATCTTCATCAAAATCATATC No data
Right 1074288803 10:112122817-112122839 AAATCATATCAAAAGAGAAGTGG No data
1074288802_1074288808 13 Left 1074288802 10:112122804-112122826 CCTATCTTCATCAAAATCATATC No data
Right 1074288808 10:112122840-112122862 AGGGGGAAAAGCTGTGTCTAAGG No data
1074288802_1074288811 24 Left 1074288802 10:112122804-112122826 CCTATCTTCATCAAAATCATATC No data
Right 1074288811 10:112122851-112122873 CTGTGTCTAAGGAGGTAGGAAGG No data
1074288802_1074288806 -5 Left 1074288802 10:112122804-112122826 CCTATCTTCATCAAAATCATATC No data
Right 1074288806 10:112122822-112122844 ATATCAAAAGAGAAGTGGAGGGG No data
1074288802_1074288810 20 Left 1074288802 10:112122804-112122826 CCTATCTTCATCAAAATCATATC No data
Right 1074288810 10:112122847-112122869 AAAGCTGTGTCTAAGGAGGTAGG No data
1074288802_1074288804 -7 Left 1074288802 10:112122804-112122826 CCTATCTTCATCAAAATCATATC No data
Right 1074288804 10:112122820-112122842 TCATATCAAAAGAGAAGTGGAGG No data
1074288802_1074288805 -6 Left 1074288802 10:112122804-112122826 CCTATCTTCATCAAAATCATATC No data
Right 1074288805 10:112122821-112122843 CATATCAAAAGAGAAGTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074288802 Original CRISPR GATATGATTTTGATGAAGAT AGG (reversed) Intergenic
No off target data available for this crispr