ID: 1074288811

View in Genome Browser
Species Human (GRCh38)
Location 10:112122851-112122873
Sequence CTGTGTCTAAGGAGGTAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074288802_1074288811 24 Left 1074288802 10:112122804-112122826 CCTATCTTCATCAAAATCATATC No data
Right 1074288811 10:112122851-112122873 CTGTGTCTAAGGAGGTAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074288811 Original CRISPR CTGTGTCTAAGGAGGTAGGA AGG Intergenic
No off target data available for this crispr