ID: 1074290092

View in Genome Browser
Species Human (GRCh38)
Location 10:112131840-112131862
Sequence GAGAGGGTCAAATGCGGGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074290092_1074290098 -3 Left 1074290092 10:112131840-112131862 CCAACCCCGCATTTGACCCTCTC No data
Right 1074290098 10:112131860-112131882 CTCTACAGCCTCTTCCCGTGAGG No data
1074290092_1074290102 21 Left 1074290092 10:112131840-112131862 CCAACCCCGCATTTGACCCTCTC No data
Right 1074290102 10:112131884-112131906 ATTTTCATTTATGTGTATGTTGG No data
1074290092_1074290103 22 Left 1074290092 10:112131840-112131862 CCAACCCCGCATTTGACCCTCTC No data
Right 1074290103 10:112131885-112131907 TTTTCATTTATGTGTATGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074290092 Original CRISPR GAGAGGGTCAAATGCGGGGT TGG (reversed) Intergenic
No off target data available for this crispr