ID: 1074290098

View in Genome Browser
Species Human (GRCh38)
Location 10:112131860-112131882
Sequence CTCTACAGCCTCTTCCCGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074290095_1074290098 -9 Left 1074290095 10:112131846-112131868 CCGCATTTGACCCTCTCTACAGC No data
Right 1074290098 10:112131860-112131882 CTCTACAGCCTCTTCCCGTGAGG No data
1074290093_1074290098 -7 Left 1074290093 10:112131844-112131866 CCCCGCATTTGACCCTCTCTACA No data
Right 1074290098 10:112131860-112131882 CTCTACAGCCTCTTCCCGTGAGG No data
1074290094_1074290098 -8 Left 1074290094 10:112131845-112131867 CCCGCATTTGACCCTCTCTACAG No data
Right 1074290098 10:112131860-112131882 CTCTACAGCCTCTTCCCGTGAGG No data
1074290086_1074290098 12 Left 1074290086 10:112131825-112131847 CCCCCCTCTTCTCCGCCAACCCC No data
Right 1074290098 10:112131860-112131882 CTCTACAGCCTCTTCCCGTGAGG No data
1074290088_1074290098 10 Left 1074290088 10:112131827-112131849 CCCCTCTTCTCCGCCAACCCCGC No data
Right 1074290098 10:112131860-112131882 CTCTACAGCCTCTTCCCGTGAGG No data
1074290089_1074290098 9 Left 1074290089 10:112131828-112131850 CCCTCTTCTCCGCCAACCCCGCA No data
Right 1074290098 10:112131860-112131882 CTCTACAGCCTCTTCCCGTGAGG No data
1074290087_1074290098 11 Left 1074290087 10:112131826-112131848 CCCCCTCTTCTCCGCCAACCCCG No data
Right 1074290098 10:112131860-112131882 CTCTACAGCCTCTTCCCGTGAGG No data
1074290092_1074290098 -3 Left 1074290092 10:112131840-112131862 CCAACCCCGCATTTGACCCTCTC No data
Right 1074290098 10:112131860-112131882 CTCTACAGCCTCTTCCCGTGAGG No data
1074290090_1074290098 8 Left 1074290090 10:112131829-112131851 CCTCTTCTCCGCCAACCCCGCAT No data
Right 1074290098 10:112131860-112131882 CTCTACAGCCTCTTCCCGTGAGG No data
1074290091_1074290098 0 Left 1074290091 10:112131837-112131859 CCGCCAACCCCGCATTTGACCCT No data
Right 1074290098 10:112131860-112131882 CTCTACAGCCTCTTCCCGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074290098 Original CRISPR CTCTACAGCCTCTTCCCGTG AGG Intergenic
No off target data available for this crispr