ID: 1074290102

View in Genome Browser
Species Human (GRCh38)
Location 10:112131884-112131906
Sequence ATTTTCATTTATGTGTATGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074290097_1074290102 4 Left 1074290097 10:112131857-112131879 CCTCTCTACAGCCTCTTCCCGTG No data
Right 1074290102 10:112131884-112131906 ATTTTCATTTATGTGTATGTTGG No data
1074290091_1074290102 24 Left 1074290091 10:112131837-112131859 CCGCCAACCCCGCATTTGACCCT No data
Right 1074290102 10:112131884-112131906 ATTTTCATTTATGTGTATGTTGG No data
1074290093_1074290102 17 Left 1074290093 10:112131844-112131866 CCCCGCATTTGACCCTCTCTACA No data
Right 1074290102 10:112131884-112131906 ATTTTCATTTATGTGTATGTTGG No data
1074290099_1074290102 -7 Left 1074290099 10:112131868-112131890 CCTCTTCCCGTGAGGTATTTTCA No data
Right 1074290102 10:112131884-112131906 ATTTTCATTTATGTGTATGTTGG No data
1074290092_1074290102 21 Left 1074290092 10:112131840-112131862 CCAACCCCGCATTTGACCCTCTC No data
Right 1074290102 10:112131884-112131906 ATTTTCATTTATGTGTATGTTGG No data
1074290095_1074290102 15 Left 1074290095 10:112131846-112131868 CCGCATTTGACCCTCTCTACAGC No data
Right 1074290102 10:112131884-112131906 ATTTTCATTTATGTGTATGTTGG No data
1074290094_1074290102 16 Left 1074290094 10:112131845-112131867 CCCGCATTTGACCCTCTCTACAG No data
Right 1074290102 10:112131884-112131906 ATTTTCATTTATGTGTATGTTGG No data
1074290096_1074290102 5 Left 1074290096 10:112131856-112131878 CCCTCTCTACAGCCTCTTCCCGT No data
Right 1074290102 10:112131884-112131906 ATTTTCATTTATGTGTATGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074290102 Original CRISPR ATTTTCATTTATGTGTATGT TGG Intergenic
No off target data available for this crispr