ID: 1074290829

View in Genome Browser
Species Human (GRCh38)
Location 10:112137037-112137059
Sequence GCAGTGTGGGAGTAGAGCCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074290829_1074290836 16 Left 1074290829 10:112137037-112137059 CCGGGGCTCTACTCCCACACTGC No data
Right 1074290836 10:112137076-112137098 CCAATGCCCAGCATGCACACAGG No data
1074290829_1074290833 -7 Left 1074290829 10:112137037-112137059 CCGGGGCTCTACTCCCACACTGC No data
Right 1074290833 10:112137053-112137075 ACACTGCATAGCAGCTGCCAGGG No data
1074290829_1074290832 -8 Left 1074290829 10:112137037-112137059 CCGGGGCTCTACTCCCACACTGC No data
Right 1074290832 10:112137052-112137074 CACACTGCATAGCAGCTGCCAGG No data
1074290829_1074290839 24 Left 1074290829 10:112137037-112137059 CCGGGGCTCTACTCCCACACTGC No data
Right 1074290839 10:112137084-112137106 CAGCATGCACACAGGTGCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074290829 Original CRISPR GCAGTGTGGGAGTAGAGCCC CGG (reversed) Intergenic
No off target data available for this crispr