ID: 1074292895

View in Genome Browser
Species Human (GRCh38)
Location 10:112154117-112154139
Sequence TGGGATTAGGACCACAATCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 113}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074292895 Original CRISPR TGGGATTAGGACCACAATCT TGG (reversed) Intronic
902204236 1:14855622-14855644 TGGCATTAGGAACACAAACCTGG + Intronic
904704202 1:32378096-32378118 TGGGATCAGGACCAGGGTCTAGG - Intronic
905345579 1:37309009-37309031 TGGGACTAGCACCACAGTCCAGG + Intergenic
910342486 1:86203520-86203542 TGAGATTTGAACCACAGTCTTGG + Intergenic
910476295 1:87611038-87611060 TGGGCTTAGGACTACAGGCTGGG - Intergenic
911709503 1:101053897-101053919 TGGGATTGGGACATCAATATAGG - Intergenic
914938683 1:152003135-152003157 TGGGAACATAACCACAATCTGGG + Intergenic
916052711 1:161047697-161047719 TGTGATTAGGACCACAGCCCTGG - Exonic
917721675 1:177791948-177791970 TGGAATCAGGACCACAACCCGGG - Intergenic
921099655 1:211917467-211917489 TTGAATTAGGAGCAAAATCTAGG + Intergenic
923671034 1:236041686-236041708 TGGGATTAGGACCATGGTTTTGG - Intronic
924024497 1:239818262-239818284 CTGGATTAGGACCCCAACCTTGG + Intronic
1063100511 10:2945796-2945818 CTGGGTTAGGACTACAATCTGGG - Intergenic
1065581221 10:27173918-27173940 TGGGCTCAGGACCACAATGTTGG + Intronic
1071889848 10:89991891-89991913 TGGCATTAGGACCTAAATTTAGG - Intergenic
1074292895 10:112154117-112154139 TGGGATTAGGACCACAATCTTGG - Intronic
1075589937 10:123684049-123684071 TGGGGTTAGGTCCACACCCTCGG - Intronic
1076687869 10:132206216-132206238 TGGGATGAGGACAACCGTCTGGG - Intergenic
1083275243 11:61593394-61593416 TGAGATCAGGACCAAAGTCTGGG + Intergenic
1085331015 11:75651098-75651120 TGGGGATATGACCCCAATCTGGG + Intronic
1085624926 11:78064467-78064489 GGGTATTGGGACCACAACCTAGG + Intronic
1085837107 11:79968876-79968898 AGGAATTAGGAAAACAATCTTGG + Intergenic
1087608545 11:100406597-100406619 GGGGATTAGGACTTCAATATAGG - Intergenic
1087758860 11:102084339-102084361 TGGGATAAAGACGATAATCTTGG + Exonic
1087890326 11:103530935-103530957 CAGGATGAGGACCAGAATCTAGG + Intergenic
1097392482 12:59032594-59032616 TGGAATTGGGACCAGAAACTGGG + Intergenic
1099852786 12:88123737-88123759 AAGGTTTAGGACAACAATCTAGG - Intronic
1106149949 13:27089800-27089822 TGGGCTTAGAAAAACAATCTAGG - Intronic
1109674347 13:65654244-65654266 TTGGATGAGGACAGCAATCTGGG + Intergenic
1117803826 14:59469753-59469775 TGGGAAGAGGGCCACAGTCTAGG + Intronic
1122360884 14:101162395-101162417 AGGGCTAAGGACCACACTCTAGG - Intergenic
1122536174 14:102464792-102464814 TGGGATTAGTATCTCAATGTGGG - Intronic
1123792054 15:23731572-23731594 TGGCATTAAGACAACAATCAGGG - Intergenic
1125427949 15:39568364-39568386 TTGGATTAGGGCCACAATAATGG + Intergenic
1128833508 15:70790536-70790558 TGGGATAAGTGGCACAATCTGGG - Intergenic
1134374825 16:13662105-13662127 GGGAATTGAGACCACAATCTGGG - Intergenic
1151737339 17:75952182-75952204 TTGTATTTTGACCACAATCTTGG + Intronic
1155060545 18:22224333-22224355 TGGTATTAGGAACACAGGCTGGG + Intergenic
1156053819 18:32972739-32972761 TGGGATTATTAGCACAAGCTGGG + Intronic
1161948526 19:7454091-7454113 TGGGATTAGCAGCACCATCTTGG + Intronic
1165677080 19:37735693-37735715 GGGCATTGGGACCACAAACTGGG + Intergenic
925290551 2:2745514-2745536 TGGGATTAGGATCACACACGTGG - Intergenic
932086039 2:68762532-68762554 TGGAATTAGGACCGCATCCTGGG + Intronic
936039981 2:109142395-109142417 TGGGGTTAGCTCCACAAACTTGG + Intronic
941395336 2:164966732-164966754 TGTGATTAGGAAAACAATGTAGG + Intergenic
941555284 2:166971999-166972021 GGGGATTAGGACCTCAACATAGG - Intronic
944587793 2:201187948-201187970 TAGAATCAGGACCAGAATCTAGG - Intronic
1169123194 20:3109728-3109750 TGAGATCTGGGCCACAATCTAGG + Exonic
1169521738 20:6380872-6380894 TGGCATTAGGAACAGAATCCAGG - Intergenic
1171207123 20:23289801-23289823 TGGGATTTGGACCACATCCTTGG - Intergenic
1171377784 20:24705607-24705629 AGGAATTTGGACCACAAGCTAGG + Intergenic
1172510842 20:35499929-35499951 TGGGAGTAGGTCCACAATGGCGG + Intronic
1178734849 21:35139799-35139821 AGCCATTAGGCCCACAATCTAGG + Intronic
949131103 3:502199-502221 TGGGAGTAGTGGCACAATCTGGG - Intergenic
949744997 3:7280441-7280463 TGGGATTTGAATCACAATCCTGG - Intronic
951109244 3:18782507-18782529 TGGGATAAGGCCCACAGTCTGGG + Intergenic
953734360 3:45479172-45479194 TGGCTCTAGGACCAGAATCTTGG - Intronic
954913741 3:54131410-54131432 TGGCATAAGGACCTCACTCTGGG - Intronic
955341794 3:58130703-58130725 TGGGATTCTGAGCACAAGCTGGG - Intronic
955651431 3:61198385-61198407 TGGGTGTATGACCACAAGCTTGG - Intronic
956271073 3:67447471-67447493 TTTGATTATGCCCACAATCTGGG + Intronic
956778311 3:72585011-72585033 TGTGATTATAACCACAATCAAGG + Intergenic
959187596 3:103065815-103065837 TGGGAGTAGGACCTCGATCTGGG - Intergenic
960906879 3:122610534-122610556 TTGGAGGAGGACCACTATCTCGG + Exonic
969357511 4:6639097-6639119 TGGGAATGGGACAACAAGCTAGG + Intergenic
972790335 4:42365578-42365600 TGGGTTTGGCACCACAATTTTGG + Intergenic
976087286 4:81419341-81419363 TGGGACTAGAACCACAATCTAGG - Intergenic
984697515 4:182794188-182794210 TGGGATTGGGACTCCAATTTTGG - Intronic
985803156 5:2019353-2019375 TGGAATTAGAACCAAAGTCTGGG + Intergenic
986192357 5:5509331-5509353 TGTGAGTGGGACCACAAGCTTGG - Intergenic
989770790 5:45142777-45142799 TGGAAATAGGACCCAAATCTAGG - Intergenic
992956839 5:81918671-81918693 CAGGATTAGGACCACACTTTGGG - Intergenic
993627689 5:90245539-90245561 TGGCTCTAGGACCACAATTTTGG - Intergenic
994357725 5:98812905-98812927 TGAGATATGGATCACAATCTTGG - Intergenic
994660843 5:102652131-102652153 TGGCATTAGGAGTAGAATCTTGG - Intergenic
995915069 5:117235597-117235619 TAGGATTAGAACCACATTCTGGG - Intergenic
997845088 5:137278882-137278904 TGGGGTTAGGACTACTATCTGGG - Intronic
1006843420 6:37046637-37046659 TGGGGTTAGGACTTCAATATAGG - Intergenic
1010933790 6:81835890-81835912 AGGCATTAGGACAACAATCATGG - Intergenic
1019790872 7:3013115-3013137 TGGGATTAGGATCTCAACATAGG - Intronic
1021914653 7:25419358-25419380 GGGGATTAGGACCACAGTCATGG - Intergenic
1024554804 7:50594185-50594207 TGGGGTGAGGAACAGAATCTGGG - Intronic
1025749896 7:64284669-64284691 TGGGATTATGACCTATATCTAGG - Intergenic
1028408350 7:90500689-90500711 TGGGATTTGGGCCATAATTTGGG - Intronic
1031845801 7:126804962-126804984 TGGTAAGAGGACCACAGTCTGGG - Intronic
1035134643 7:156689754-156689776 TGAGATGATGACAACAATCTTGG + Intronic
1035491027 7:159278614-159278636 TGGGTATAGGATCAGAATCTTGG - Intergenic
1035542828 8:455178-455200 GGGGATTAGGACCAGACTCAGGG + Intronic
1043001889 8:74769655-74769677 TAGGATGAGAAACACAATCTAGG + Intronic
1043282338 8:78483903-78483925 AGGGATTCAGACCACAACCTGGG - Intergenic
1043288623 8:78568037-78568059 TGGTATTAGCACCAAGATCTGGG + Intronic
1045303485 8:100935739-100935761 TAGAATTAGTACCATAATCTAGG - Intronic
1055662668 9:78520461-78520483 TGGGAGTAGGACAACCCTCTGGG - Intergenic
1057713616 9:97469491-97469513 TGTGTTTAGTACCATAATCTAGG + Intronic
1059026884 9:110644256-110644278 TGAGTTTGGGAGCACAATCTTGG + Intergenic
1059325268 9:113500488-113500510 TGGGGCTAGGACCAGAACCTGGG - Intronic
1185619879 X:1447327-1447349 TTGGATAAGCACCACCATCTTGG + Intronic
1185619891 X:1447419-1447441 TTGGATAAGCACCACCATCTTGG + Intronic
1185619906 X:1447511-1447533 TGGGAGAAGCACCACCATCTTGG + Intronic
1185619914 X:1447565-1447587 TTGGATAAGCACCACCATCTTGG + Intronic
1185619922 X:1447619-1447641 TTGGATAAGCACCACCATCTTGG + Intronic
1185619945 X:1447784-1447806 TTGGATAAGCACCACCATCTTGG + Intronic
1185619974 X:1447988-1448010 TTGGATAAGAACCACCATCTTGG + Intronic
1185619982 X:1448042-1448064 TTGGATAAGAACCACCATCTTGG + Intronic
1185619989 X:1448096-1448118 TTGGATAAGCACCACCATCTTGG + Intronic
1185619997 X:1448150-1448172 TTGGATAAGCACCACCATCTTGG + Intronic
1185620003 X:1448188-1448210 TTGGATAAGCACCACCATCTTGG + Intronic
1185620010 X:1448242-1448264 TTGGATAAGCACCACCATCTTGG + Intronic
1185620017 X:1448296-1448318 TTGGATAAGCACCACCATCTTGG + Intronic
1185620047 X:1448495-1448517 TTGGATAAGCACCACCATCTTGG + Intronic
1185620055 X:1448552-1448574 TTGGATAAGCACCACCATCTTGG + Intronic
1185620063 X:1448606-1448628 TTGGATAAGCACCACCATCTTGG + Intronic
1185620069 X:1448644-1448666 TTGGATAAGCACCACCATCTTGG + Intronic
1185620085 X:1448752-1448774 TTGGATAAGCACCACCATCTTGG + Intronic
1185620091 X:1448790-1448812 TTGGATAAGCACCACCATCTTGG + Intronic
1186598669 X:11011972-11011994 TGGAATTAGGGCCACAACTTAGG - Intergenic
1189346174 X:40243104-40243126 TGGGTTTAGGACTTCAACCTAGG + Intergenic
1190908810 X:54753730-54753752 TGGGATTTGGATCACAAAGTGGG + Exonic
1193043430 X:77027517-77027539 CTGGATTTGGACCACAAACTTGG - Intergenic
1193193926 X:78607156-78607178 TGTGATTAGGGCAACAATGTTGG - Intergenic
1193213426 X:78835324-78835346 TGGGTTTAGGAGAAGAATCTTGG - Intergenic
1196654390 X:118201798-118201820 TGGGAAAAGGACCATTATCTTGG + Intergenic
1197219062 X:123894315-123894337 TGGAACTAGGACCACAAGCAAGG + Intronic