ID: 1074299660

View in Genome Browser
Species Human (GRCh38)
Location 10:112222452-112222474
Sequence TGCCAGGTATAGCAAATAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074299660_1074299666 19 Left 1074299660 10:112222452-112222474 CCACCTATTTGCTATACCTGGCA No data
Right 1074299666 10:112222494-112222516 GGTATTCAATGAATGCCAGATGG No data
1074299660_1074299667 20 Left 1074299660 10:112222452-112222474 CCACCTATTTGCTATACCTGGCA No data
Right 1074299667 10:112222495-112222517 GTATTCAATGAATGCCAGATGGG No data
1074299660_1074299663 -6 Left 1074299660 10:112222452-112222474 CCACCTATTTGCTATACCTGGCA No data
Right 1074299663 10:112222469-112222491 CTGGCATAGATCCTTGTACTTGG No data
1074299660_1074299668 26 Left 1074299660 10:112222452-112222474 CCACCTATTTGCTATACCTGGCA No data
Right 1074299668 10:112222501-112222523 AATGAATGCCAGATGGGTGAAGG No data
1074299660_1074299664 -2 Left 1074299660 10:112222452-112222474 CCACCTATTTGCTATACCTGGCA No data
Right 1074299664 10:112222473-112222495 CATAGATCCTTGTACTTGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074299660 Original CRISPR TGCCAGGTATAGCAAATAGG TGG (reversed) Intergenic
No off target data available for this crispr