ID: 1074300398

View in Genome Browser
Species Human (GRCh38)
Location 10:112227828-112227850
Sequence CAGACAGGCAAGAGGGAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 911
Summary {0: 2, 1: 0, 2: 11, 3: 84, 4: 814}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074300398_1074300408 18 Left 1074300398 10:112227828-112227850 CCCTCTTCCCTCTTGCCTGTCTG 0: 2
1: 0
2: 11
3: 84
4: 814
Right 1074300408 10:112227869-112227891 GAGCAATTGCCTGCCCAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074300398 Original CRISPR CAGACAGGCAAGAGGGAAGA GGG (reversed) Intergenic
900148265 1:1167603-1167625 CTGTCCGGCAGGAGGGAAGATGG - Intergenic
900739541 1:4322301-4322323 CAGAGAGCCAAAAGGGAAGGTGG + Intergenic
900816928 1:4854879-4854901 CAGAAAGTTAAGAGGGAAGTGGG - Intergenic
900947360 1:5838622-5838644 GAGACAGGCAAGCGGGAGGCTGG + Intergenic
901440192 1:9273076-9273098 CCGACAGGTGAGTGGGAAGATGG - Intergenic
901536122 1:9883916-9883938 CAAACAGTCAAGGAGGAAGAAGG + Intronic
902134988 1:14297466-14297488 GAGACAGGCAAAGGAGAAGAGGG + Intergenic
902192004 1:14770319-14770341 TAGCCAGGCAAGAAGGAGGATGG + Intronic
902240283 1:15083805-15083827 CAAACTGGCAAGAGGCAGGATGG - Intronic
902420363 1:16274406-16274428 CAGACAGGAAAGGGGCATGAGGG + Intronic
902490898 1:16779630-16779652 CAGACAGGGAGGAGGGAAACTGG + Intronic
902615339 1:17620598-17620620 CAGGCAGGGCAGTGGGAAGATGG + Intronic
902908894 1:19580446-19580468 CAGAGAGGATTGAGGGAAGATGG + Intergenic
902931641 1:19735577-19735599 GAAACTGGAAAGAGGGAAGAGGG - Intronic
903033929 1:20482295-20482317 CAGACAGGAAGGAGGGATGGTGG - Intergenic
903128358 1:21262687-21262709 CAGACAGGTGTTAGGGAAGAGGG - Intronic
903239575 1:21974005-21974027 CTGCCCCGCAAGAGGGAAGATGG - Intergenic
903243383 1:21998932-21998954 CTGCCCCGCAAGAGGGAAGATGG - Intergenic
903261851 1:22135895-22135917 GAGACAGGAAAGAGGGAAAGGGG - Intronic
903551097 1:24157732-24157754 CCAACAGACAAGATGGAAGAAGG - Exonic
904041234 1:27586347-27586369 GAGACAGGCAGAAGGGGAGAGGG + Intronic
905278305 1:36833333-36833355 CTGACAGGTCAGAAGGAAGAGGG - Intronic
905365022 1:37446213-37446235 GAGAGAGGAGAGAGGGAAGAGGG - Intergenic
905745141 1:40409645-40409667 AAACCAGGCAAGAGGGAAGGAGG + Intronic
906012107 1:42537457-42537479 CAAAAAGGCAAGAAGGTAGAGGG - Intronic
906434915 1:45787238-45787260 CAGACAAGCAAAAGTGAACATGG - Intronic
906501240 1:46342878-46342900 CAGAGAGGCAGGAGGGAGGTGGG - Intronic
906580110 1:46929237-46929259 CAGACAAGCAGGCAGGAAGAAGG + Exonic
906603618 1:47149656-47149678 CAGACAAGCAGGCAGGAAGAAGG - Exonic
907323849 1:53622645-53622667 CAGACAGGGAAGAGGCGACATGG + Intronic
907471017 1:54673507-54673529 CTGACAGACTATAGGGAAGAAGG - Intronic
907491172 1:54809826-54809848 AAGACAGGTACGAGGGAAGGTGG - Intronic
907573543 1:55505783-55505805 CAGACATGAGAAAGGGAAGAGGG - Intergenic
909765604 1:79352414-79352436 CGGTCAGTCAAGAGGGAAGGGGG + Intergenic
910052572 1:82992904-82992926 CAGAAAGGCAAAGGGGAAGCAGG - Intergenic
910979061 1:92940281-92940303 TAAACAGGCAAGAGAGAAAAAGG - Intronic
911035122 1:93534824-93534846 CAAACAGGAGAGTGGGAAGATGG + Exonic
911142136 1:94515881-94515903 AAGAAAGGAAAGAGGGAAGGGGG - Intronic
911629264 1:100164301-100164323 TACACAGGCAAGGGGTAAGAAGG - Intronic
911705597 1:101008748-101008770 TAGATAGGCAAGAGGGCAGAAGG - Intronic
911721610 1:101197172-101197194 CAGTCAGGAATGAGGGAAAAAGG + Intergenic
911815695 1:102346989-102347011 CATACAGGCATGAGGGAGGCAGG + Intergenic
912531660 1:110328438-110328460 CAGTCAGCCAACAGGAAAGAAGG - Intergenic
912802406 1:112728391-112728413 AGGAGAGGGAAGAGGGAAGAGGG - Intergenic
912942551 1:114058127-114058149 CAAGCCAGCAAGAGGGAAGATGG - Intergenic
913112271 1:115667015-115667037 GAAACAGACAGGAGGGAAGAGGG + Intronic
913314061 1:117535232-117535254 CGGACAGGGGAGAGGGGAGACGG - Intergenic
913963612 1:143357141-143357163 AAGAGAGGAGAGAGGGAAGAGGG - Intergenic
914057972 1:144182730-144182752 AAGAGAGGAGAGAGGGAAGAGGG - Intergenic
914121174 1:144783635-144783657 AAGAGAGGAGAGAGGGAAGAGGG + Intergenic
914833289 1:151186623-151186645 TAGACAGCCAAGAGGGAGGAAGG + Intronic
914919368 1:151837304-151837326 GGAAGAGGCAAGAGGGAAGAAGG + Intergenic
915163240 1:153933880-153933902 CAGAAAAGAATGAGGGAAGATGG + Intronic
915178943 1:154041684-154041706 AAGAGAGGCAAGTGGGAAGATGG - Intronic
915713382 1:157922294-157922316 AAGAAAGGAAAGAAGGAAGAAGG + Intergenic
916348371 1:163820478-163820500 CAGATAAGCCAGAGGGAGGAAGG + Intergenic
916604855 1:166330979-166331001 CAGAAAGGCCAGAGGAATGAAGG + Intergenic
916846584 1:168657077-168657099 GACACAGGCAACAGGGGAGAAGG - Intergenic
917382879 1:174434045-174434067 AAGACTGGCAAGAGGTATGAGGG - Intronic
917823194 1:178788045-178788067 AAGACAGGAAAGATGTAAGATGG - Intronic
917930894 1:179821765-179821787 CGGAGAAGCAAGAGGGACGATGG + Intergenic
919434381 1:197538897-197538919 CAGAAAGGCAAGAGAGATGAGGG - Intronic
919611647 1:199752415-199752437 CAGTCAGGCAAGAAGCAAGCAGG + Intergenic
919804939 1:201375934-201375956 CAGACATGCAGGATGGAGGAGGG + Intronic
919933600 1:202237080-202237102 CACAGAGGCAGGAGGGTAGAGGG - Intronic
920634437 1:207686020-207686042 CAGGCAGGCAGAAGGGAAGGAGG - Intronic
920764192 1:208815965-208815987 CAGAAAGGCAAAAGGGAAGAAGG + Intergenic
920789046 1:209071234-209071256 CAGACAGGCTTCAGGGAAAATGG + Intergenic
921221422 1:212976763-212976785 CAGATGGGCAGGAGGGCAGAGGG - Intronic
921304570 1:213782883-213782905 CAGACAGGCTGGAGTGAAGTTGG + Intergenic
921422908 1:214969200-214969222 CAGAAAGGTAAGAGTGAAAAAGG - Intergenic
923247568 1:232147399-232147421 AAGAAAGAAAAGAGGGAAGAAGG + Intergenic
923585899 1:235270619-235270641 CAAACAGGCAAGAGAGAAATTGG + Intronic
923699695 1:236288159-236288181 CTGACAAAGAAGAGGGAAGATGG - Intergenic
923867458 1:237955222-237955244 CAGAAAGGCAGGAGGAAAGTTGG - Intergenic
923881211 1:238105693-238105715 CAGAGAGGCAAGAGGTGAGCTGG + Intergenic
924256474 1:242188190-242188212 CAGAGCGGCAAGAGGGAGGGCGG + Intronic
924406732 1:243755398-243755420 AAGACAGGCAAGGAGTAAGAAGG - Intronic
924559130 1:245143212-245143234 CAGACAGACAGGTGGGCAGATGG - Intergenic
1063365293 10:5486884-5486906 CTGACAGGCAAGAGGCCAGATGG + Intergenic
1063687778 10:8254958-8254980 CAAAGAGGGGAGAGGGAAGATGG - Intergenic
1064199797 10:13274664-13274686 CAGAAAAGCAAAAGGGAAGAGGG - Intergenic
1064442093 10:15363303-15363325 AAGACAGACAACATGGAAGAGGG + Intronic
1065234618 10:23636545-23636567 AAGAAAGGCAAGAGAGAAAAAGG - Intergenic
1065694843 10:28370258-28370280 GAGAAAGGAAAGAGGGAAGGAGG + Intergenic
1065722754 10:28642447-28642469 CAGAGAGGGGAGAGGGGAGAAGG - Intergenic
1067911935 10:50355274-50355296 GGGAGAGGGAAGAGGGAAGAGGG - Intronic
1069586419 10:69606848-69606870 CAGTAAGGCAAGGGGGAAAAAGG + Intergenic
1069860326 10:71467146-71467168 CAGAGACCCCAGAGGGAAGAGGG + Intronic
1070146067 10:73774094-73774116 CAGACAGGGGAGAGAGAAAATGG + Intronic
1071157982 10:82713154-82713176 AAGACAGGCAAGAGGGCTAATGG + Intronic
1071166024 10:82807772-82807794 AAGACAGGAAACAGGGAAAAAGG - Intronic
1071288706 10:84172732-84172754 CAGACTGGCAAAAGGGAGGCCGG - Intergenic
1071495016 10:86162226-86162248 CAGGGAGGAAAAAGGGAAGAGGG + Intronic
1071675646 10:87653573-87653595 AAGAAAGGAAAGAAGGAAGAAGG - Intergenic
1071920739 10:90347194-90347216 CAGACAAGGAAGAAGGAACAAGG + Intergenic
1071969240 10:90886281-90886303 AAGAGAGTCAAGAGGGAACAGGG + Intronic
1074031671 10:109695206-109695228 AAGACAGGGGAAAGGGAAGAGGG + Intergenic
1074107382 10:110398672-110398694 CATCCAGGCAAGAGGGAAATGGG - Intergenic
1074232168 10:111548551-111548573 CAGAGAGGCCAGAGAGAAAAGGG - Intergenic
1074300398 10:112227828-112227850 CAGACAGGCAAGAGGGAAGAGGG - Intergenic
1075239484 10:120765017-120765039 AAGACAGGCCAGGGGGAGGAGGG - Intergenic
1075656248 10:124163028-124163050 CAGGCAGGCAGGAGGAAGGAAGG + Intergenic
1076530787 10:131142994-131143016 GAGAGAGGCAAGATGGACGAGGG + Intronic
1076923862 10:133471504-133471526 GAGACAGCCCAGAGGGAGGAAGG - Intergenic
1077163246 11:1123089-1123111 GAGAGAGGGAAGAGGGAGGAAGG - Intergenic
1077338411 11:2015585-2015607 CAGACAGCAGGGAGGGAAGAGGG - Intergenic
1077792281 11:5453952-5453974 AAGAAAGGGAAGAGGGAAAAGGG - Exonic
1078122237 11:8522768-8522790 TAGAAAGGAAAGAGGAAAGAGGG - Intronic
1078452309 11:11449396-11449418 CAGACAGTGAAGAGGGAGAAGGG - Intronic
1079424034 11:20323429-20323451 CAGAGAGGCAAAAAGGAAGAAGG - Intergenic
1079505758 11:21150324-21150346 CAGACTGGCAGGGGGGCAGAGGG + Intronic
1079524953 11:21374972-21374994 CAAACAGAGAAGAAGGAAGAAGG + Intronic
1079659501 11:23021006-23021028 CAGACAACCCAGAAGGAAGAAGG - Intergenic
1080821167 11:35807933-35807955 CAGACAGGCAGGCAGGAAAAGGG - Exonic
1080838710 11:35964605-35964627 GATGCAGGCTAGAGGGAAGAAGG + Intronic
1083101454 11:60310743-60310765 CCAACAGGAAAGAGGAAAGATGG - Intergenic
1083344295 11:61978763-61978785 CAGAGAAGCATGAGGAAAGAAGG - Intergenic
1083876429 11:65526435-65526457 CAGCCAGGCAGCAGGGAACAGGG - Intronic
1083996294 11:66274727-66274749 GAGAAAGGCAAGAGGGGAGAGGG - Intronic
1084101870 11:66955205-66955227 CTGAGAGGACAGAGGGAAGAGGG + Intronic
1084214811 11:67641504-67641526 CTGGCAGGCAAGATGGATGAGGG - Intergenic
1085400410 11:76232573-76232595 GAGACAGGGAGGAGGGGAGAGGG - Intergenic
1085526617 11:77167727-77167749 CAGGCAGGCAGGAAGGAAGAAGG - Intronic
1087330096 11:96770450-96770472 CAGAGAGGAAATAGGAAAGACGG - Intergenic
1087498289 11:98917996-98918018 CACATAGGGATGAGGGAAGATGG + Intergenic
1087838959 11:102903126-102903148 CAGAAAGCTAAGTGGGAAGATGG + Intergenic
1088106539 11:106212830-106212852 CAGAGAGGCTACAGGGAAGCAGG + Intergenic
1088135637 11:106552615-106552637 CAGACAGGCTACTGGGCAGAAGG + Intergenic
1088275599 11:108082203-108082225 AAGAAAGGAAAGAGGGAGGAAGG - Intronic
1088394120 11:109348027-109348049 GAGACAGGAAGGAAGGAAGAAGG - Intergenic
1088440701 11:109867197-109867219 CAGTCAGGCATGAGGGCAGCAGG + Intergenic
1089327982 11:117670411-117670433 CAGACAGGCAAGCAGGCAGGAGG + Intronic
1089492070 11:118890018-118890040 CAGACAGGGAGGAGAGAAGCAGG - Intronic
1090212979 11:124935906-124935928 CAGACAGGTAGGAGGCCAGAGGG - Exonic
1090245389 11:125212622-125212644 CAGAGAGGGAAGAGAGGAGAGGG + Intronic
1090419928 11:126567672-126567694 GTGACAGGAAAGAGGGAAGGTGG + Intronic
1090825703 11:130384118-130384140 CAGACAGGCCAGAGTGCACATGG + Intergenic
1090887611 11:130893028-130893050 AAGACACAAAAGAGGGAAGAAGG + Intronic
1090988892 11:131798353-131798375 CATCTAGGAAAGAGGGAAGATGG + Intronic
1091172036 11:133528096-133528118 CAGACAGGACCGAGGGAACATGG + Intronic
1091230865 11:133987171-133987193 CAGGAAGGCAGGAAGGAAGAAGG + Intergenic
1091278293 11:134367145-134367167 CAGACAGGGAAGAGTAGAGAGGG + Intronic
1202821395 11_KI270721v1_random:70767-70789 CAGACAGCAGGGAGGGAAGAGGG - Intergenic
1091547323 12:1510132-1510154 GAGACACGCCAGAGGGAGGAAGG - Intergenic
1091575387 12:1728871-1728893 AAGAGAGTCAAGATGGAAGATGG - Intronic
1091622282 12:2098231-2098253 CAGGCAGACAAGAAGGTAGAAGG - Intronic
1092051529 12:5474278-5474300 CAGACAGGCAAGAAAAAGGATGG + Intronic
1092859364 12:12706878-12706900 CAAAGAGGCAAGAGAGAAGTAGG - Intergenic
1093045186 12:14435113-14435135 GAGACAGGAAGGAAGGAAGAGGG + Intronic
1093247044 12:16752013-16752035 GATACTGTCAAGAGGGAAGAGGG + Intergenic
1093658981 12:21732257-21732279 GAGACAGGAAAGAGAGAAAATGG - Intronic
1094027885 12:25978042-25978064 CAGATAAGCAAGTGGGTAGAAGG - Intronic
1095177940 12:39114643-39114665 AAGACAGCAAAGAGGAAAGAAGG - Intergenic
1095201932 12:39394952-39394974 GAGATAGGTAAGAGAGAAGAAGG - Intronic
1095223056 12:39641502-39641524 AAGACAGGCAAGGGGAAGGAAGG + Intronic
1095493664 12:42762205-42762227 CAGACAGGGAGGAAGGATGATGG - Intergenic
1095512230 12:42964933-42964955 CAGAGAGGCAAGAGGTAGAAAGG - Intergenic
1095654113 12:44649221-44649243 CAGACAAGAAGGAGGGAAGGAGG - Intronic
1095846456 12:46751046-46751068 CTGACAAGCCAGAGGGAAAATGG + Intergenic
1095921523 12:47536208-47536230 CAGACAGACAGCAGAGAAGAAGG + Intergenic
1096023543 12:48342070-48342092 AAGACAGTCAAGAGGAGAGAGGG + Exonic
1096309660 12:50509529-50509551 CAGACAGGAGAAAGGGAGGATGG - Intronic
1096468756 12:51863678-51863700 CACACAGGTCAGAGGGATGAGGG + Intergenic
1096613992 12:52821472-52821494 CAGACAGGGAAGGGGGATGTGGG + Exonic
1096748330 12:53743151-53743173 AAGACAGGAAAGAAGAAAGAAGG - Intergenic
1096871402 12:54594755-54594777 CAGACACACAAGAGGGAAGAAGG - Intergenic
1096896522 12:54826243-54826265 CTCACAGTGAAGAGGGAAGAGGG - Intergenic
1096985796 12:55756163-55756185 CAGACAGAAAAGAGGGAAAAGGG + Exonic
1097263097 12:57730717-57730739 AAGAGGGGTAAGAGGGAAGAGGG - Intronic
1097428498 12:59474514-59474536 CAGAAAGGAAAGAGAGAAAAAGG + Intergenic
1097798037 12:63884682-63884704 GAGACTGGGAAGCGGGAAGAGGG - Intronic
1097811205 12:64021126-64021148 CAGAATGGAAACAGGGAAGAAGG + Intronic
1098098801 12:66990478-66990500 AAGAGAGAAAAGAGGGAAGAAGG + Intergenic
1100515451 12:95323144-95323166 AAGAAAGGAAAGAAGGAAGAAGG + Intergenic
1101035865 12:100705828-100705850 CAGAAAAGAAAGAGGGAAGGAGG - Intergenic
1101111850 12:101494161-101494183 GAGACAGGGAAGTGGCAAGAGGG - Intergenic
1101232464 12:102755368-102755390 CAGACAAGAAAGAGTGAACAAGG + Intergenic
1101494272 12:105238606-105238628 GAGAAAGGCAGGAGTGAAGAAGG + Intronic
1101577450 12:106011146-106011168 CAGACACCCAGCAGGGAAGAAGG + Intergenic
1101783857 12:107864543-107864565 CAGACAATCAAGAGGGAAAGAGG - Intergenic
1102013495 12:109633066-109633088 CAGGCAGGCAGGAGGGAGGGAGG + Intergenic
1102039689 12:109792839-109792861 AAGAGAGGCCAGAGGGGAGAGGG + Intronic
1102097236 12:110250391-110250413 GAGACAGGAGAGAGGGAAGGTGG - Intergenic
1102464530 12:113120683-113120705 CAAGTAGGCAAGAGGGAAGATGG + Intronic
1102518955 12:113467473-113467495 CAGTCAGGGAAGGGAGAAGAGGG - Intronic
1102547569 12:113667661-113667683 CAGAGAGAAAAGAGGGGAGATGG - Intergenic
1102724083 12:115043322-115043344 CAGACAAGCAAGAGAAAACAAGG - Intergenic
1103164324 12:118757165-118757187 AAGGCAGGAAAGAGGGAAGGAGG + Intergenic
1103366967 12:120390568-120390590 AAGGGAGGGAAGAGGGAAGAAGG + Intergenic
1103672161 12:122626742-122626764 GAGCCAGACAAAAGGGAAGAAGG + Intergenic
1104368510 12:128199966-128199988 CAGAGAGGAAGGAGGAAAGAAGG - Intergenic
1104415342 12:128593136-128593158 GAGAGAGGAGAGAGGGAAGAAGG - Intronic
1104415361 12:128593312-128593334 GAGAGAGGAGAGAGGGAAGAGGG - Intronic
1104980646 12:132571819-132571841 CAGACAGGCCTGAGGGCACAGGG + Intronic
1105284887 13:18995663-18995685 AAAACAGGCTAGAGGGCAGAAGG + Intergenic
1105689764 13:22824642-22824664 CACACAGGCAAGAAGGTAGTAGG + Intergenic
1105812701 13:24008881-24008903 CAGCCAAGGAGGAGGGAAGAGGG + Intronic
1106281387 13:28275748-28275770 CAGAATGGCAGGAGGGAAGCTGG - Intronic
1106402028 13:29440644-29440666 CAGATGGTCGAGAGGGAAGATGG - Intronic
1106883393 13:34156611-34156633 TCGACAGGCAAGGGGGCAGAAGG - Intergenic
1107044694 13:35982212-35982234 CACAAAGGAAAGAGGGAACAAGG + Intronic
1107377747 13:39822717-39822739 CAGAGAGGCAAGAACGAGGAAGG - Intergenic
1107563444 13:41578137-41578159 AAGAAAGGGAAGAGGGAAGAAGG - Intronic
1108434721 13:50390371-50390393 CAGTCTGGCAAGAGTGATGAAGG - Intronic
1108551952 13:51555340-51555362 TACACAGGCAAGAGAGAACATGG + Intergenic
1108974098 13:56415750-56415772 GAGACAGGCATGATGGAAGATGG - Intergenic
1109260422 13:60138780-60138802 AAGAAGGGGAAGAGGGAAGAGGG + Intronic
1109370558 13:61415297-61415319 CAGAAAGGCAAGAGGGCAGAAGG + Exonic
1109411410 13:61973758-61973780 CAGACACCCAAGAGTGAATAAGG - Intergenic
1110257544 13:73448530-73448552 CAAACACCCAAGAGGGGAGACGG + Intergenic
1110552158 13:76822096-76822118 CAGATAGGCAGAAAGGAAGATGG - Intergenic
1110619991 13:77584670-77584692 CAGGCAGGAAAGAGGTAACAAGG - Intronic
1110739327 13:78976333-78976355 GACACAGGGAAGAGAGAAGAGGG + Intergenic
1111098992 13:83555871-83555893 CATACCAGCAAGAGGGAGGATGG + Intergenic
1111119606 13:83829603-83829625 CAGACTGTTAAGAGGGCAGAAGG + Intergenic
1111962156 13:94823501-94823523 CAGACCAGCAAGATGGAAGGTGG + Intergenic
1111994539 13:95151505-95151527 CAAAGAGGAAAGAAGGAAGAAGG + Intronic
1112057330 13:95702232-95702254 CAGACTGGGAAGAGGCAGGAGGG - Intronic
1112541495 13:100318043-100318065 AGGAAGGGCAAGAGGGAAGATGG - Intronic
1112574987 13:100627544-100627566 GAGACAGACAAGAGGTGAGATGG - Intronic
1114004746 14:18300410-18300432 TAAATTGGCAAGAGGGAAGAAGG + Intergenic
1114624945 14:24122942-24122964 AGGACAGGCAAGAGTGGAGAGGG - Intronic
1115447281 14:33505816-33505838 CAGCCTGGGAAGAGGGGAGATGG - Intronic
1116149133 14:41116230-41116252 CAGACAGACAAAAAGGAGGAGGG + Intergenic
1117347983 14:54852809-54852831 CAGACAAACACGATGGAAGAGGG - Intronic
1117503402 14:56376354-56376376 CAGATAGGAAAGTGAGAAGAAGG - Intergenic
1118307037 14:64663396-64663418 CAGGAAGGCAAGAGGGCAGGTGG + Intergenic
1118356148 14:65015516-65015538 CAGCCTGGCAAGGGGGAGGAGGG - Intronic
1118470503 14:66070546-66070568 CAGACAAACAACAGGCAAGATGG - Intergenic
1118982601 14:70728859-70728881 CAGAGAGTCTTGAGGGAAGAGGG + Intronic
1119180546 14:72602092-72602114 CACAAAGGCAAGATAGAAGATGG + Intergenic
1119435723 14:74596646-74596668 CAGAGAGGCAGCAGGGAAGCAGG + Intronic
1119535334 14:75398412-75398434 CAGAAAAGGAAAAGGGAAGAAGG + Intergenic
1119666558 14:76489199-76489221 CAGACAGACTGGAGGGGAGATGG - Intronic
1119831473 14:77707025-77707047 ATAACAGGCAAGAGGGAAAACGG - Intronic
1120414916 14:84207318-84207340 TACACAGGCAAGAGGAAAGCCGG + Intergenic
1120648558 14:87102703-87102725 AAGAAGGGCAAGAGGGAAGAGGG - Intergenic
1120750639 14:88194618-88194640 GAGATGGGCAGGAGGGAAGATGG + Intronic
1121015012 14:90543860-90543882 CCAACAGGCAAGAGGGCAGCAGG + Intronic
1121399681 14:93662653-93662675 CAGGTAGGCCAGAGTGAAGACGG - Exonic
1121406988 14:93725154-93725176 CAGACAGGAAAGCAGGCAGAGGG + Intronic
1121492271 14:94369089-94369111 CAGGTAGGAGAGAGGGAAGAGGG + Intergenic
1121585266 14:95058899-95058921 CATCCAGGCAAGAGGGAGGAGGG + Intergenic
1121624618 14:95374985-95375007 GAGAGAGGAAAGAAGGAAGAGGG - Intergenic
1121624649 14:95375088-95375110 GAGAGAGGAAAGAAGGAAGAGGG - Intergenic
1121624678 14:95375202-95375224 GAGAGAGGAAAGAAGGAAGAGGG - Intergenic
1121624716 14:95375327-95375349 GAGAGAGGAAAGAAGGAAGAGGG - Intergenic
1121725058 14:96141272-96141294 GAGACAGACAAGAGGGTGGAGGG + Intergenic
1121828396 14:97029177-97029199 AAGAGAAGAAAGAGGGAAGAAGG - Intergenic
1121882598 14:97514375-97514397 CAGGCAGGCAAGAGGGAGGAAGG - Intergenic
1121916037 14:97837646-97837668 CAGACAGGGAACAGGGAGGCAGG - Intergenic
1121952168 14:98181022-98181044 GAGAGAGGAAAGAAGGAAGAAGG - Intergenic
1122029360 14:98901341-98901363 CAGACATAGAAGAGGGAAGAGGG + Intergenic
1122058246 14:99119560-99119582 CTGAGAAGCAAGAGGGAATAGGG - Intergenic
1122083768 14:99285373-99285395 CAGACAAGCAGGAGAGAAGGTGG - Intergenic
1122122956 14:99564318-99564340 CAGACCCACAAGATGGAAGAGGG + Intronic
1122238033 14:100344063-100344085 GGGAGAGGGAAGAGGGAAGAGGG - Intronic
1122689927 14:103527455-103527477 CAGAGAGGCAAGAGGGAAGTCGG + Intergenic
1122782509 14:104149643-104149665 CAGAGGGGCAACAGGGAAAAGGG - Intronic
1123106666 14:105845016-105845038 CAGGCAGCCAAGCAGGAAGAAGG + Intergenic
1123571747 15:21618556-21618578 CACACAGGCCAGGGGTAAGATGG + Intergenic
1123608363 15:22061152-22061174 CACACAGGCCAGGGGTAAGATGG + Intergenic
1124091118 15:26601827-26601849 AAGACAGGAAAGAAGAAAGAAGG + Intronic
1124224669 15:27882877-27882899 TAGACAGGCATGAAGCAAGATGG - Intronic
1124584779 15:30994417-30994439 CAGTCAGGGAGGAGGGCAGAGGG + Intergenic
1124590839 15:31051570-31051592 CAGACAGGGAAGAGGAAAGCTGG - Intronic
1124602938 15:31149834-31149856 CAGAATGTCAAGATGGAAGAGGG - Intronic
1124829267 15:33132179-33132201 CAGCCAGGAAAGAAGGAAGAGGG - Intronic
1124918481 15:33999789-33999811 AAGACTGGCAAGAGGGGAGCGGG - Intronic
1125296386 15:38207983-38208005 GAGAGAGGCAAAGGGGAAGACGG + Intergenic
1125431069 15:39593898-39593920 CAGACAGAGAGGAGGGAAGGAGG - Intronic
1125483561 15:40096994-40097016 ATGACAGGGAAAAGGGAAGAGGG - Intronic
1125971892 15:43918455-43918477 CAGAAAAGGAGGAGGGAAGAAGG - Intronic
1126122706 15:45267901-45267923 GAGATAGGCAAGAAGGAATATGG - Intronic
1126567593 15:50115960-50115982 CAGAGAGACAAAAGGGAACAAGG - Intronic
1126569436 15:50134349-50134371 AAGAAAGGCAAGTGAGAAGAGGG + Intronic
1126584029 15:50265696-50265718 AGGACTGGCAAGAGGGAAGCCGG - Exonic
1126667722 15:51090295-51090317 CACTAAGGCAAGATGGAAGAGGG - Intronic
1126941830 15:53776030-53776052 CCGAGAAGCAAGAGGGAAGCCGG - Intergenic
1127159674 15:56168794-56168816 AAGGCAGGAAAAAGGGAAGAAGG - Intronic
1127175150 15:56346237-56346259 CAGAGAGGCAGGAGAGAAGCAGG + Intronic
1127249451 15:57215917-57215939 CAGAAAAGTAAGATGGAAGAGGG + Intronic
1127429396 15:58887372-58887394 CAGACAGGCGAGAAGTACGAGGG - Exonic
1127528297 15:59816120-59816142 CAGACATGCAAGGGTGGAGATGG + Intergenic
1127849747 15:62902186-62902208 CTCACAGACAATAGGGAAGAAGG + Intergenic
1127907576 15:63387646-63387668 CAGAGAGGGAAGGGGGAGGAAGG + Intergenic
1128123611 15:65173393-65173415 CAGACAGACAAGTGGTAAAAAGG + Intronic
1128570826 15:68731558-68731580 TAGGGAGGCAACAGGGAAGAGGG + Intergenic
1129360114 15:75019329-75019351 CAGAGGGGCCAGAGGCAAGAGGG - Exonic
1130205071 15:81868284-81868306 GAGACAGGAAAGAGGAAGGAGGG - Intergenic
1130393537 15:83480942-83480964 CAAACAGGCACCAGGCAAGAAGG - Intronic
1130747450 15:86671050-86671072 GAGACAGGTAAGAGAGAAGAGGG - Intronic
1130907653 15:88251771-88251793 CAGCCAGGCAGGAGGGTAGTAGG + Intronic
1130957848 15:88639654-88639676 CAGATGGGCACCAGGGAAGAGGG - Intronic
1131166556 15:90145850-90145872 CAGAGAGGCAAGAGAGGGGATGG + Intergenic
1131425442 15:92342017-92342039 CACACAGGCAAGCAGAAAGAAGG - Intergenic
1131529522 15:93179838-93179860 CAGACAGGGAAGAGGGAGAAAGG + Intergenic
1131602777 15:93866409-93866431 CTCAGAGGCATGAGGGAAGAAGG + Intergenic
1131856595 15:96603572-96603594 CAGACAAGCGGCAGGGAAGATGG + Intergenic
1131967398 15:97858952-97858974 GAGACAGACAATTGGGAAGATGG - Intergenic
1132209744 15:100011255-100011277 CAGAAAGGAAGGAAGGAAGAAGG + Intronic
1132405961 15:101542044-101542066 CTGACATCCAAGAGGGAAGATGG - Intergenic
1202980602 15_KI270727v1_random:352951-352973 CACACAGGCCAGGGGTAAGATGG + Intergenic
1133158099 16:3889942-3889964 CAGACAGGAAAGAAGGAAGAAGG - Intergenic
1133181794 16:4060326-4060348 CAGGCAGGAAAGACTGAAGAGGG + Intronic
1133422117 16:5654775-5654797 GAGAGAGGAAAGAAGGAAGAAGG - Intergenic
1134072359 16:11268740-11268762 ACCACAGGCAAGAAGGAAGAGGG - Intronic
1134258884 16:12634550-12634572 AAGATGGGAAAGAGGGAAGAGGG + Intergenic
1134298841 16:12971413-12971435 CAGCCAGCCAAGAGACAAGAGGG - Intronic
1135613414 16:23888457-23888479 CAGAAAGGCAGCAAGGAAGATGG - Intronic
1135874597 16:26186511-26186533 GAGACAGGCTGGAGAGAAGAAGG - Intergenic
1136096310 16:27959569-27959591 CAGAAGGGCAAAAGGGAGGACGG + Intronic
1136157297 16:28391762-28391784 CCTACAGGCACGAGGCAAGAAGG - Exonic
1136205789 16:28723519-28723541 CCTACAGGCACGAGGCAAGAAGG + Exonic
1137674607 16:50298104-50298126 CAGAGAGGAAAGAGGGAATGGGG - Intronic
1137777322 16:51066757-51066779 CAGACAGGCAAAAGGGAACTTGG - Intergenic
1138053797 16:53811515-53811537 CTGACAGTGAAGAGGAAAGATGG - Intronic
1138131557 16:54484353-54484375 TAGACAGGCAGGGAGGAAGAGGG + Intergenic
1138444408 16:57054631-57054653 CAGCAAGGCAATAGGGAAGCAGG - Intronic
1139345311 16:66299377-66299399 CAGGCAGAAAACAGGGAAGAAGG - Intergenic
1139917560 16:70438037-70438059 CTGTAAAGCAAGAGGGAAGATGG + Intronic
1139955985 16:70693226-70693248 CAGACAGGCAGGTGGGCAGGTGG - Intronic
1140232288 16:73127284-73127306 CAGGCAGAGAAGAGGGAAGAAGG + Exonic
1140409404 16:74733047-74733069 CAGACAGGCAAGAGGCAGCTTGG - Intronic
1140693125 16:77503858-77503880 GAGACAGAGAAGAGGGAGGAGGG + Intergenic
1140726378 16:77816794-77816816 AAGACAGGAAGGAGTGAAGAAGG + Intronic
1140857477 16:78990687-78990709 CATAGAGGAAAGAAGGAAGAAGG + Intronic
1140904115 16:79395884-79395906 GAGACAGGCAAGAAGCAGGAAGG + Intergenic
1140906694 16:79415352-79415374 CAGGCAGGCAAGAAGGAGGAAGG + Intergenic
1141186113 16:81788807-81788829 CAAACAGTCAAGAGGGAAGATGG - Intronic
1141756243 16:85992985-85993007 CAGAAAGACAGAAGGGAAGAAGG - Intergenic
1141768000 16:86071340-86071362 CAGCCAGGCAAGTGGGGAAACGG + Intergenic
1142418808 16:89957800-89957822 GAGACAGGCAGGGTGGAAGACGG + Intronic
1142488955 17:265558-265580 AAGGGAGGGAAGAGGGAAGAGGG - Intronic
1142562939 17:821832-821854 GAGACAGGGAAGGGGGAGGAAGG - Intronic
1142697061 17:1639623-1639645 CAGCCAGGTAAGGTGGAAGAAGG - Exonic
1142712258 17:1730067-1730089 AAGAGAGGCCAGAGGGAAGGTGG + Intronic
1142730535 17:1852525-1852547 CAGGAAGGCCAGAGGGCAGAGGG + Intronic
1143371238 17:6441384-6441406 ATCACAGGCAAGAGGGAATATGG + Intergenic
1143576089 17:7794208-7794230 CAGACAGGCAGGAGGGGAGAGGG - Intronic
1143590114 17:7880200-7880222 CAGACAGAAGAGAGGGGAGAGGG + Intronic
1143590299 17:7882053-7882075 CAGACAGGCAAAAGGGAGGATGG + Intronic
1143591292 17:7886908-7886930 CAGAAAGCCAAGAGGGAAAGGGG - Intronic
1143613340 17:8033902-8033924 AAGACAGGAAAGAGGAAGGAAGG + Intergenic
1144113501 17:12062895-12062917 AAGACTGGGAAAAGGGAAGAGGG - Intronic
1144560249 17:16315412-16315434 CAGAAAGGCCAGAGTGAGGAGGG - Intronic
1146085916 17:29829503-29829525 GAGAGAGGAGAGAGGGAAGAAGG + Intronic
1146489443 17:33269675-33269697 CAGGCAGGCAGGAGGGAGGGAGG - Intronic
1146797752 17:35795004-35795026 CAGACGGGCAAGAGCCCAGAGGG - Intronic
1147177973 17:38668607-38668629 CAGACACAGAAGAGTGAAGAGGG + Intergenic
1147535829 17:41322901-41322923 CAGACATAGAGGAGGGAAGATGG - Intergenic
1147538616 17:41337046-41337068 AAGAAAGGAGAGAGGGAAGAGGG - Intergenic
1147544865 17:41393529-41393551 CAGGCAGGCCAGTGGGAAGGAGG - Intronic
1148243089 17:46012781-46012803 CACCCAGGCCAGAGGGAAGAGGG + Intronic
1148371118 17:47100393-47100415 CAGAAAGGGGAGAGGGAAGCTGG + Intergenic
1148696927 17:49566202-49566224 CAGACAGCCAAGAAGGAAAGGGG + Intergenic
1148735187 17:49861172-49861194 GAGAAAGGCAAGAGGGAGGAAGG - Intergenic
1148746276 17:49920111-49920133 CGGACAGGTAGGAGGGCAGAGGG - Intergenic
1148761403 17:50003594-50003616 CGGTGAGGCAAGAGGGTAGATGG + Intergenic
1149258666 17:54855725-54855747 CAGGCAGGCAAAAGGGTACAAGG + Intergenic
1150207442 17:63419771-63419793 CAGAGAGGCCAGAAGGAAGATGG + Intronic
1150425768 17:65075843-65075865 CAGAAGGGCAAGAAGGAAGCAGG - Intergenic
1150471181 17:65438775-65438797 GAGGCATGCAAGAGGGAAGAGGG - Intergenic
1150711172 17:67531987-67532009 CAGAGAGGCAGGAAGGCAGATGG + Intronic
1150810383 17:68351772-68351794 CAGACAGGAAACAGTTAAGACGG + Intronic
1151065738 17:71147805-71147827 CAGAGAGGAAAAAGGGAGGAGGG - Intergenic
1151194824 17:72424015-72424037 GAGAAAGACAAGAGGAAAGACGG + Intergenic
1151349708 17:73524566-73524588 CAGTCATGCTAGAGGGAAGAGGG - Intronic
1151450145 17:74193813-74193835 CAGAAAGGTAAGAAGGAAGTGGG + Intergenic
1152003220 17:77660302-77660324 GAGAAAGGAAAGAAGGAAGAAGG - Intergenic
1152697287 17:81803662-81803684 CAGGCAGGCATCAGGAAAGAAGG + Intergenic
1152698868 17:81809439-81809461 CAGACAGGCAGGCAGGCAGACGG - Intronic
1152698904 17:81809687-81809709 CAGACAGGCAGGCAGGTAGATGG - Intronic
1152853766 17:82652033-82652055 CTTACAGGAAAGAGGGAAGGGGG + Intergenic
1153465188 18:5380708-5380730 CAGGCAGGCATGAGGCAGGAGGG - Intergenic
1153723955 18:7936634-7936656 CAGACAGGCTCCAGGGCAGATGG + Intronic
1153885263 18:9458792-9458814 GAGAAAGGAAAGAAGGAAGAAGG + Intergenic
1154346336 18:13546367-13546389 CAGGCAAGCAAGAGGGGAGGGGG - Intronic
1155029451 18:21971596-21971618 GAGACAGGGAAGAGGGACAAGGG - Intergenic
1155041332 18:22067802-22067824 CTGCCAGGCAAGAGGGAATAAGG + Intergenic
1155533648 18:26793927-26793949 CAGAAAGGCAGGAAGGCAGAAGG - Intergenic
1155724433 18:29062004-29062026 CAGAAAGAGAAGAGTGAAGAAGG - Intergenic
1156346812 18:36264400-36264422 CAAAGAGGTAAGAGGTAAGAGGG + Intronic
1156514563 18:37669209-37669231 CAGAAAGGGCAGAGGGAAGTGGG - Intergenic
1157121488 18:44915597-44915619 CAGACGGGCAAGATGAGAGACGG + Intronic
1157177502 18:45464975-45464997 CAGGCAGGCAGGAGAGAAGTAGG + Intronic
1157265444 18:46215956-46215978 GAGACAGCCAAGGAGGAAGATGG + Exonic
1157439197 18:47697134-47697156 CAGACAGGGCACAGAGAAGAGGG - Intergenic
1157523190 18:48359505-48359527 CAGACAGGCCAGATGTACGAAGG + Intronic
1157534475 18:48448240-48448262 CAGATTGGCAAGGGGGAAGTCGG - Intergenic
1157618657 18:49002800-49002822 CACAAAGGCATGTGGGAAGAAGG - Intergenic
1157826841 18:50819955-50819977 CAGGCTGGCATGAGGGAAGAAGG - Exonic
1157885204 18:51359972-51359994 CAGAGAGGCCAGTGGGAAGCTGG - Intergenic
1158123518 18:54077168-54077190 GAGACAGGGAAGGGGGAAGGAGG - Intergenic
1158130650 18:54148995-54149017 TAGAAAGGCAAGAGGAAATATGG - Intergenic
1158318510 18:56237979-56238001 CAGACAGGCCCCAGGGAAGAAGG + Intergenic
1158575036 18:58629518-58629540 CAGACAGACAAGGGGTAAGGGGG - Intergenic
1159214654 18:65375164-65375186 AAGGCAGGCAGGAAGGAAGAAGG - Intergenic
1159796981 18:72855747-72855769 CAGTCAGGCAAGATGGAACCAGG + Intronic
1160064488 18:75562162-75562184 TCGTCAGGCAAGAGGGGAGAGGG + Intergenic
1160261192 18:77295759-77295781 GAGACAGGCAAGGGAGAAGGTGG + Intergenic
1160404873 18:78638362-78638384 GAGACACGGAAGAGGGCAGACGG - Intergenic
1160576962 18:79861728-79861750 CTGAAAGGAAAGAGGGAACAGGG - Intergenic
1161157175 19:2738575-2738597 CAGAGAAGCAAGAAAGAAGAAGG - Intronic
1162059429 19:8085841-8085863 CAGAAGGGACAGAGGGAAGAGGG + Intronic
1162157794 19:8691439-8691461 CAGAAAGGGAAGAGGGAGGGAGG - Intergenic
1162736093 19:12747947-12747969 CAGCCAGGGCAGAGGGTAGAAGG - Intronic
1163591712 19:18197434-18197456 AAGACAGGGAAGAGGGGAAAGGG + Exonic
1163703194 19:18797125-18797147 GAGACAGGGAGGAGGGAAGAAGG - Intergenic
1164874850 19:31676815-31676837 AAGAAAGGAAAGAGGGAAGGAGG - Intergenic
1165278948 19:34780580-34780602 GAGACAGGGAGGAGGGAGGAAGG + Intergenic
1165825753 19:38704908-38704930 CACACAGGGAAGGGGGCAGAGGG - Intronic
1166231573 19:41427998-41428020 AAGACGGGCAAGTGGGAAGGTGG + Intronic
1166588969 19:43978523-43978545 CAGACACACACGAGGGTAGATGG - Intronic
1166690955 19:44821010-44821032 GGGAGAGGGAAGAGGGAAGAGGG - Exonic
1167487914 19:49773939-49773961 CAGAGAGGGAACAGGGTAGATGG + Intronic
1167607475 19:50489127-50489149 GAGACAGACATTAGGGAAGAAGG + Exonic
1167656444 19:50767427-50767449 CAGAGAGGGAAGCGGGCAGATGG - Intergenic
1167665214 19:50819571-50819593 CAGACAGGTTAGGGGGAGGAGGG + Intronic
1167772536 19:51530235-51530257 AAAACAAGCAAGAGAGAAGAGGG + Intronic
1168020709 19:53606832-53606854 CAGATGGGGAAGAGGGAAGAGGG - Intergenic
1202697455 1_KI270712v1_random:135398-135420 AAGAGAGGAGAGAGGGAAGAGGG - Intergenic
925328967 2:3043628-3043650 GAGACAGGGAAGAGGAGAGACGG + Intergenic
925659178 2:6184280-6184302 TGGACAGGAAGGAGGGAAGAAGG + Intergenic
926001856 2:9339733-9339755 CAGATAGTGAAGAAGGAAGAGGG - Intronic
926072489 2:9909492-9909514 CAGAGAGGCAAGTGAGAATATGG + Intronic
926731555 2:16039407-16039429 GAGACAGGGAGGAGGGAGGAAGG - Intergenic
926828383 2:16932772-16932794 CAGTCAGAAAAGGGGGAAGAGGG - Intergenic
927268164 2:21176382-21176404 CAGACAGGAAAGAGTTCAGAAGG + Intergenic
927653909 2:24929386-24929408 GAGACAGGAGAGAGGGAAGATGG - Intergenic
929562210 2:42963014-42963036 CAGGGAGGGAGGAGGGAAGAGGG - Intergenic
929891142 2:45919423-45919445 AAGAGAGGCCAGAGGGCAGAAGG - Intronic
930324463 2:49897827-49897849 CAGACAGGCAGGAAGCAAAAGGG + Intergenic
930711499 2:54555067-54555089 CAAAGAGGAAAGAGGGTAGATGG - Intronic
930747641 2:54901285-54901307 AAGACAGGCAACACGGCAGAGGG - Intronic
931304143 2:61012403-61012425 GAGACAGACAGGAGGGCAGAAGG - Intronic
932706672 2:74031318-74031340 CAGACAGGCCAGAGAGACGAGGG + Intronic
933093265 2:78146646-78146668 CAGACAGGCTCTTGGGAAGAAGG + Intergenic
933408570 2:81895359-81895381 CAGAAAGGAGAGAGGGGAGACGG - Intergenic
934278625 2:91592422-91592444 AAGAGAGGAGAGAGGGAAGAGGG - Intergenic
934650120 2:96085836-96085858 CAGAGAGGCAGGAGGGACCAAGG + Intergenic
934991541 2:98925110-98925132 GGGAGAGGCAAGAGGGAAGGAGG + Intronic
935371561 2:102352146-102352168 CAGGCAAGCAAAAGGGAAAAGGG - Intronic
935553173 2:104479676-104479698 CAACCAGGAAGGAGGGAAGAAGG + Intergenic
935856409 2:107279245-107279267 AAGGCAGGGAAAAGGGAAGAGGG + Intergenic
936513588 2:113167782-113167804 CAGACAGCTGGGAGGGAAGAGGG + Intronic
937010144 2:118555542-118555564 CAGGTGGGCAAGAGGAAAGAAGG + Intergenic
937994925 2:127686073-127686095 CAAGCAGGCAAGAAGGAAAAAGG - Intergenic
938064284 2:128272658-128272680 GAGACAGGGAGGAGAGAAGAGGG + Intronic
938903231 2:135816228-135816250 CAGAGAGGGAAGAGGCAAGGAGG - Intronic
938934394 2:136116362-136116384 CAGGGAGGGAAGAGGGGAGAAGG + Intronic
939454533 2:142417082-142417104 AAGACAGGCAAAAGAAAAGAAGG - Intergenic
940101799 2:150048621-150048643 GAGACAGGCAAGAAGGAGAAGGG + Intergenic
940656118 2:156489809-156489831 GAAACAGGAAAGAGGGAAGAGGG - Intronic
941170034 2:162125269-162125291 CAGACAGGGAGGAGGGAGGGGGG - Intergenic
942229009 2:173842252-173842274 GAGAAAGGAAAGAGAGAAGATGG + Intergenic
942352031 2:175063018-175063040 CAGACTGGCAAGAGGGAGCCAGG - Intergenic
942525077 2:176844339-176844361 CATACAGGGAAGAAGGAATAGGG - Intergenic
942559807 2:177208710-177208732 ATTACAGGCATGAGGGAAGAAGG - Intergenic
943049803 2:182900894-182900916 AAGATAGGGAAAAGGGAAGAAGG - Intergenic
943521932 2:188962304-188962326 CAGGCAGGCAAGAAGGAAGGAGG + Intergenic
943629222 2:190232359-190232381 CAGACTGCCAAAAGGGAAGTAGG - Intronic
944057643 2:195540054-195540076 CAGACAGGCAGGAAGCAAAAGGG - Intergenic
944145494 2:196503351-196503373 CAGAGGGGCAAGATAGAAGAGGG + Intronic
944910499 2:204306015-204306037 CACACAGACAAAAAGGAAGATGG - Intergenic
945685248 2:212960971-212960993 GAGACAAGGAAGAGGGAGGAAGG + Intergenic
946057933 2:216917788-216917810 AAGACAGACGAGGGGGAAGATGG + Intergenic
946322379 2:218961395-218961417 CAGTCAGGCAAGGGGTAAGATGG - Exonic
946322399 2:218961493-218961515 AAGGCAGACAGGAGGGAAGATGG - Exonic
946410229 2:219511883-219511905 CAGGCAGGGAAGCGGGGAGAGGG + Intergenic
946607482 2:221421443-221421465 CAGGCAGGAGAGAGGGAACATGG + Intronic
946774556 2:223124153-223124175 CAGAGAGGAAAGGGAGAAGAGGG - Intronic
946987840 2:225292886-225292908 AAGACAGGAGAGAAGGAAGAAGG - Intergenic
947042776 2:225942489-225942511 GAGAAGGGGAAGAGGGAAGAGGG + Intergenic
947077353 2:226359778-226359800 CAGGCAGGAGAGAGGGAGGAAGG + Intergenic
947937716 2:234022329-234022351 CAACTAGGCAAGAGAGAAGAAGG - Intergenic
948248130 2:236503677-236503699 GAGACAGTCTCGAGGGAAGAGGG - Intronic
948309427 2:236973990-236974012 CAGTGAGGCTAGAGGCAAGATGG - Intergenic
948381289 2:237551512-237551534 AAGACATGCAAAAGTGAAGAAGG + Intronic
948577699 2:238965145-238965167 AAGTGAGGCAAGAGGGAAGAGGG - Intergenic
948577742 2:238965295-238965317 AAGTGAGGCAAGAGGGAAGAGGG - Intergenic
948624125 2:239257528-239257550 CTGACAGGCAGGAGAGAAGGAGG + Intronic
948708291 2:239809464-239809486 CACACAGGGAGGAGGGAGGAGGG - Intergenic
948783435 2:240338863-240338885 CAGAAGGCGAAGAGGGAAGAGGG - Intergenic
948857908 2:240738835-240738857 CAGACAGGAGAGAAGGAAGAGGG - Intronic
948868874 2:240788442-240788464 CAGCCAGGCAGGAGGCAGGACGG + Intronic
1169276505 20:4236729-4236751 CAGACAGGAAGGAGGGAGGCAGG + Intronic
1169329914 20:4708264-4708286 CAGGCAGGCAGGAGGCAACAAGG - Intergenic
1169803383 20:9534149-9534171 CAGACAGCCAAGAGGGTCCAGGG + Intergenic
1169995064 20:11547039-11547061 GAGAAAGACCAGAGGGAAGAAGG + Intergenic
1170711962 20:18799266-18799288 AAGAAAGCCAAGAGGAAAGAAGG - Intergenic
1170759292 20:19235639-19235661 CAGACAGGTAAGAAGCCAGAAGG - Intronic
1170915883 20:20625033-20625055 CAGAAAAGCAAGAGGGAGGGAGG - Intronic
1171105743 20:22430764-22430786 CAGAAAGACAAGAGAGAAGTAGG + Intergenic
1171289010 20:23969493-23969515 CATTGAGGCCAGAGGGAAGATGG + Intergenic
1172515409 20:35529459-35529481 CCGACAGGACAGAGGGAAGCTGG - Intronic
1172687016 20:36763435-36763457 AAGTCAGGCAATAGGCAAGAGGG + Intronic
1172789217 20:37490980-37491002 CAGAGAGTGTAGAGGGAAGATGG - Intergenic
1172824936 20:37773862-37773884 AAGACAGGAAAGAAAGAAGAAGG - Intronic
1172839536 20:37893904-37893926 CAGAGAGGAAAGAAGGAAGGAGG - Intergenic
1173334192 20:42099733-42099755 GTTACAAGCAAGAGGGAAGAGGG + Intronic
1173813550 20:45971133-45971155 CTGACAGCCAAGAGGAAACAAGG - Intronic
1173946422 20:46954359-46954381 CAGACAGGGAGGAAGGAAGGGGG + Intronic
1173959037 20:47057124-47057146 AAGACAGGAAGGAGGGAGGAAGG + Intronic
1174316781 20:49709302-49709324 CATAAAGGCCAGAGGGTAGAGGG + Intronic
1174687085 20:52466358-52466380 CAGACAGAATAGAGGGAGGATGG + Intergenic
1174823063 20:53744138-53744160 CAGGCAGGCAGGCGGGAAGGGGG - Intergenic
1175005505 20:55678025-55678047 AAGAAAGCCAAGAGGGGAGATGG + Intergenic
1175623498 20:60470577-60470599 CAGACATGCAGGAGTGAGGATGG + Intergenic
1175826957 20:61941732-61941754 GTGACAGGAAAGAGGGAAGCAGG - Intergenic
1176160040 20:63643096-63643118 CAGACAGGGAAGCTGGAGGAAGG - Intronic
1176163175 20:63658856-63658878 CAGCCAGCCAGGAGGGCAGAGGG + Intronic
1176216269 20:63949418-63949440 CTGTCAGTCAAGAAGGAAGACGG + Intronic
1176242581 20:64081898-64081920 CAGACAGGCAAGAGGGAAGAGGG - Intronic
1178359881 21:31939926-31939948 CAGACAGCAAAGAGGACAGAAGG - Intronic
1178639564 21:34335166-34335188 GAGACAGACCAGAAGGAAGATGG + Intergenic
1178669116 21:34575345-34575367 AGGAGAGGCAAGAGGGAAGGAGG - Intronic
1178730816 21:35101037-35101059 CAGAGAGGGAAGAGGGTTGAGGG - Intronic
1180081491 21:45489747-45489769 CAGACAGCCGGGAGGGAGGAAGG - Intronic
1180429260 22:15231200-15231222 TAAATTGGCAAGAGGGAAGAAGG + Intergenic
1180786900 22:18552603-18552625 CAGACAGCCATCAGCGAAGAAGG + Intergenic
1181000809 22:19987057-19987079 CAGACAGGTTGGAGGGAAGTTGG - Intronic
1181234841 22:21442707-21442729 CAGACAGCCATCAGCGAAGAAGG - Exonic
1181243809 22:21492124-21492146 CAGACAGCCATCAGCGAAGAAGG + Intergenic
1181503817 22:23337493-23337515 CAGGAAGGCAAGAGGGATGGGGG + Intergenic
1181654658 22:24287028-24287050 CAGAAAGGTAAGAGGGATGGGGG + Intronic
1181708813 22:24667713-24667735 CAGGAAGGCAAGAGGGATGGGGG + Intergenic
1181884098 22:26005529-26005551 CTGAAAAGCAAGAAGGAAGATGG - Intronic
1181901519 22:26160134-26160156 GAGAGAGGAAAGAGGGAGGAAGG + Intergenic
1182341337 22:29623652-29623674 CAGTCAGGCAGAAGGGAAGTTGG + Intronic
1182800348 22:33026975-33026997 AAGGGAGGCAGGAGGGAAGAAGG - Intronic
1183329633 22:37212376-37212398 GAGAGAGGCAGGAGGGAGGAAGG + Intergenic
1183450480 22:37891836-37891858 CTGATAGGCAAGGGGGAAGTCGG + Intergenic
1183487391 22:38096928-38096950 CAGGGAGGGAAGAGGGAAGAAGG + Intronic
1183539639 22:38422740-38422762 AAGACAGGGAGGGGGGAAGAGGG - Intergenic
1184109725 22:42387693-42387715 GTGACAGGCAAGGGGGATGAGGG - Intronic
1184552120 22:45210049-45210071 CAGACAGGGAGGTGGGAGGACGG - Intronic
1184798598 22:46746711-46746733 CAGACAGGCAGGAGGAAAGCAGG + Intergenic
1184815302 22:46864422-46864444 CAGACAGCCAGGAGGGAAACTGG - Intronic
1185092959 22:48786213-48786235 CAGACAGCAGAGAGGAAAGAAGG - Intronic
949266031 3:2156998-2157020 GAGGCAGGCAAAAAGGAAGAAGG - Intronic
949421525 3:3871516-3871538 CAGAGATGCCAGAGGGAACATGG - Intronic
949596683 3:5555092-5555114 CACACAGGAAAGAGGGGAGTGGG - Intergenic
949606240 3:5657455-5657477 AAGTCAGGGAAGAAGGAAGAAGG - Intergenic
949671043 3:6399228-6399250 GGGACAGGCAGGAGGGAAGAAGG - Intergenic
949991631 3:9584043-9584065 TAGCCAGGGAAGAAGGAAGAGGG - Intergenic
950173505 3:10855462-10855484 GAGACAGCCAAGAAGGATGAGGG - Intronic
950173558 3:10855867-10855889 AAGAGAGGAAAGAGGGAAAAGGG - Intronic
950227917 3:11251040-11251062 AAGAAAGTCACGAGGGAAGATGG - Intronic
950610310 3:14122730-14122752 AAGACAGGCAGGAAGTAAGATGG + Intronic
950755092 3:15164178-15164200 GGGAGAGGGAAGAGGGAAGAGGG + Intergenic
951047578 3:18057692-18057714 CAAATGGGCAACAGGGAAGATGG + Intronic
951819696 3:26794411-26794433 CAGAAAGGAAAGATGGAAGGAGG + Intergenic
952320621 3:32274507-32274529 CAGACAGACAGGAAGGAGGAAGG - Intronic
952364529 3:32663441-32663463 GGGAGAGGGAAGAGGGAAGAGGG - Intergenic
952894525 3:38068976-38068998 CAGATATGGGAGAGGGAAGAGGG + Intronic
953784158 3:45897755-45897777 CAGACAAGGAAGAAAGAAGAAGG - Intronic
954146419 3:48636520-48636542 CAGACAGGAAAGAGGGCCGCTGG + Exonic
954387366 3:50251204-50251226 CAGAAGGGCAAGAGGGTGGAGGG - Intronic
954581155 3:51703571-51703593 CAGTCAGGGTAGAGGGCAGAGGG + Intronic
954696890 3:52432339-52432361 GAGTGATGCAAGAGGGAAGAAGG + Intergenic
954736997 3:52715039-52715061 CAGACAGGCTACTGGGCAGAAGG + Intronic
955753496 3:62205570-62205592 CAGAGAGCCAAGTGGTAAGAAGG + Intronic
956838782 3:73117725-73117747 CAGAAAGAAAGGAGGGAAGAGGG - Intergenic
957569164 3:81924266-81924288 CAGTGAGGGATGAGGGAAGAGGG + Intergenic
958842202 3:99220228-99220250 CAGGAAGGCAAGAGGCAGGAAGG + Intergenic
958880562 3:99664638-99664660 CACACAGGGAAGTGGGAAGAGGG - Intronic
959306568 3:104674294-104674316 CAGACACCCAAGAGGAAAGCTGG - Intergenic
959543814 3:107570816-107570838 CAGACAGGAGAGAAAGAAGAAGG + Intronic
959917921 3:111838533-111838555 CAGACAGTCAACATGGATGAAGG + Intronic
960619506 3:119625080-119625102 GAGACTGGCCAGAGGGCAGAAGG - Intronic
960722431 3:120638098-120638120 GTGGCAGGCAAGAGGGAAGCTGG - Intronic
961061342 3:123831712-123831734 CAGACACGCAAAAGGGATGTGGG + Intronic
961170126 3:124791659-124791681 AAGACAGGCTGCAGGGAAGAGGG + Intronic
961369730 3:126422123-126422145 CACTCAGCCAAGAGGGAACATGG + Intronic
961430083 3:126875212-126875234 CAGAGCAGGAAGAGGGAAGAAGG + Intronic
961501230 3:127337431-127337453 CACACAGGCAGGAGGGAAGTGGG - Intergenic
961587992 3:127950272-127950294 CAGGGAGGGAAGTGGGAAGAAGG + Intronic
961632539 3:128311922-128311944 CACAGAGTCAAGCGGGAAGAGGG - Intronic
961787701 3:129357594-129357616 CAGGCAGGAAAGAGGGGAGAAGG - Intergenic
962919964 3:139941749-139941771 CACACAGGCACGAGTGAAGAGGG + Intronic
963057709 3:141200963-141200985 CAGACAAGCCAGAGAGAAGAAGG + Intergenic
963715946 3:148804127-148804149 CCCACAGGCAAGAGGCATGAAGG + Intronic
963850531 3:150206467-150206489 CAGGCAAGGATGAGGGAAGATGG - Intergenic
964316270 3:155447537-155447559 AAAACAGGCAAGATGGAAGCTGG - Intronic
965382075 3:168002335-168002357 TAGACAGGCATGAGGCATGAAGG - Intergenic
965881583 3:173395139-173395161 CAGAGAGGCTAGTGGGAAGCGGG + Intergenic
966398554 3:179525081-179525103 CAGACAGGAGAGAAAGAAGAAGG + Intergenic
966716579 3:183018734-183018756 CAGAGAGGGAAGAGGGATGAGGG + Intronic
966883988 3:184364795-184364817 CAGATATGCAAGAAGGAAAAGGG - Intronic
966924529 3:184635813-184635835 CAGACAGACATGAGGGCACAGGG + Intronic
967309779 3:188095098-188095120 AAGACAGGCTAGAAGCAAGATGG - Intergenic
967315150 3:188144941-188144963 GAGACAGGGAAGTGGGAAGAAGG + Intergenic
967696716 3:192541200-192541222 AAGACAGACAAAAGGAAAGAAGG - Intronic
968089775 3:195892796-195892818 GAGGCAGGCAAGAGGGAGGGCGG - Intronic
968346882 3:198015957-198015979 CAGTTTGGGAAGAGGGAAGATGG + Intronic
968488929 4:879759-879781 CAGAAAGGGAAGAGGGAAGCGGG - Intronic
968650439 4:1758238-1758260 CAGCAAGGCGAGAGGGCAGAAGG + Intergenic
968762239 4:2448735-2448757 GAGGCAGGGAAGAGGGAAGGCGG + Intronic
968810464 4:2797455-2797477 CAGACAGGCCACAGGTCAGAGGG + Intronic
969057810 4:4413230-4413252 CAGACAGGAAAGAGGGCCCAGGG + Intronic
969373238 4:6747280-6747302 GAGAGAGGCGAGAGGGAAGAAGG - Intergenic
969479132 4:7437849-7437871 CAGACAGGTGAGAGGAAAGGAGG - Intronic
969722058 4:8897613-8897635 CAGACAGGAGAGAAGGAGGAGGG - Intergenic
969821352 4:9722841-9722863 CAAACAGACAAGAGGGAGAAGGG - Intergenic
970174984 4:13330567-13330589 CAGACAGGCAGGAAGCAAAAGGG - Intergenic
970423776 4:15928359-15928381 TAAACATGCAAGAGGGAACAAGG - Intergenic
970740932 4:19236855-19236877 GAGTCAGGGAAGAGGAAAGAAGG + Intergenic
970925752 4:21449921-21449943 TAGACATGTAAGAGGGTAGATGG - Intronic
971100374 4:23459539-23459561 CAGACAGGCAGGAAGGAACAAGG - Intergenic
971371411 4:26022311-26022333 CATAAAGGAAGGAGGGAAGAGGG + Intergenic
971412088 4:26384892-26384914 GGGAGAGGCAAGAGGCAAGAGGG - Intronic
971550710 4:27952649-27952671 CAGACAGAGAAGTGGGAACAAGG + Intergenic
972353045 4:38254952-38254974 AAGAAAGGAAAGAGGAAAGAAGG + Intergenic
972491091 4:39587775-39587797 AAGAAAGGAAAGAGGGAGGAAGG + Intronic
973094045 4:46175170-46175192 CAGAAAGGGAAGAGAGAAGGAGG + Intergenic
973779069 4:54271627-54271649 GAGAAAGGAAAAAGGGAAGAGGG - Intronic
973796000 4:54427421-54427443 CAGACAGGAAAGAAAGCAGAGGG + Intergenic
974718117 4:65697974-65697996 CAGGCAGACAAGAAGGAATAAGG + Intergenic
975151963 4:71032762-71032784 CAGACAGGAGAGAAAGAAGAAGG - Intergenic
975152019 4:71033076-71033098 CAGACAGGAGAGAAAGAAGAAGG - Intergenic
975228098 4:71897928-71897950 CAGATAGGAAGGATGGAAGATGG - Intergenic
975611766 4:76210883-76210905 CAAAAAGGGAAGAGGGAAAAGGG - Intronic
975642938 4:76518464-76518486 CAGACAGGCAAAAAGGAAGGAGG - Intronic
975891137 4:79029140-79029162 CAGGCAGGAGAGAGGGAGGAGGG - Intergenic
976153863 4:82121299-82121321 CAGGCAGGCGAGAAGGAGGAAGG + Intergenic
976473179 4:85453365-85453387 CAGACAGTCAAGAAGGTAGAAGG - Intergenic
976498523 4:85758643-85758665 GAGGAAGGCAAGTGGGAAGATGG + Intronic
976684158 4:87792427-87792449 CTGACAGGAAAGAAGGGAGAAGG + Intergenic
976704321 4:88006019-88006041 TACAGAGGGAAGAGGGAAGACGG + Intergenic
977186433 4:93943666-93943688 GAGACAGGCAACATGGGAGAGGG - Intergenic
977226574 4:94398894-94398916 CAGAAATGGAGGAGGGAAGAGGG - Intergenic
977301408 4:95271843-95271865 CAGTCAGGAAAGAGGGAACGAGG - Intronic
977348817 4:95853441-95853463 CTGAGAGACAAGAGGGAAGGAGG + Intergenic
978009559 4:103663034-103663056 CAGAAAGTAAAGAGGGAAGGTGG + Intronic
978013672 4:103719089-103719111 CAGAGAGGAAAGAGGGAGAAGGG - Intronic
979868699 4:125789217-125789239 CACAAAGGAAAAAGGGAAGAAGG + Intergenic
980096241 4:128494013-128494035 CAGAAAAGAAAGAAGGAAGAGGG - Intergenic
980457244 4:133060773-133060795 CAGAAAAGCAAGAGCGAAAAGGG + Intergenic
980887217 4:138776169-138776191 GAGTAAGGCAAGAGGGATGAGGG - Intergenic
981657126 4:147124576-147124598 CAGAGAGGTAGGAGGGATGAGGG - Intergenic
982084461 4:151819575-151819597 AGGACAGGCATGAGGGAAGTGGG - Intergenic
982837520 4:160140111-160140133 CATACAGACAAGAAGGAAGTTGG + Intergenic
983877607 4:172895269-172895291 AAGACAGGAAAAATGGAAGAAGG - Intronic
983907745 4:173202518-173202540 GAGACAGAAAAGAGTGAAGAGGG - Intronic
985775731 5:1840848-1840870 CACACAGGCACGTGGGAAGCTGG + Intergenic
986044325 5:4022827-4022849 CAGAAAGAAAATAGGGAAGATGG - Intergenic
986210337 5:5665640-5665662 CAGACAGCAAGGAGGGAGGAAGG + Intergenic
986256932 5:6108507-6108529 CAGGCAGGTAAGAAGGCAGACGG - Intergenic
987034130 5:14003498-14003520 CAGAGAGGTGAGAGGGAGGAAGG - Intergenic
988414771 5:30932244-30932266 CTGACAGGTAAAATGGAAGATGG - Intergenic
989183684 5:38602725-38602747 TAGACAGGCAAGAGTGGAGCAGG + Intronic
989667338 5:43871003-43871025 GAGACAGGGAAGAAAGAAGATGG - Intergenic
989736842 5:44717925-44717947 CAAAAAGGCAAGGGGCAAGAAGG - Intergenic
990142974 5:52726790-52726812 TAGACATGAAAGAAGGAAGAAGG - Intergenic
990478328 5:56183924-56183946 CAGAGAGGAAAGTGGGAAGTGGG + Intronic
990487559 5:56274194-56274216 CAGGCAGAGAAGAGGAAAGAAGG - Intergenic
990694302 5:58398678-58398700 TAGCCAGGCAAAAGGGGAGAGGG - Intergenic
990886662 5:60602128-60602150 GAGGCAGGCAAGAAGGAAGCAGG + Intronic
991079034 5:62575528-62575550 CAGAGAGGCAATTGGAAAGATGG - Intronic
991136888 5:63192978-63193000 AAGACCTGCAGGAGGGAAGATGG + Intergenic
991733893 5:69614205-69614227 GAGAGAGGAGAGAGGGAAGAGGG - Intergenic
991810327 5:70469346-70469368 GAGAGAGGAGAGAGGGAAGAGGG - Intergenic
991860373 5:71007937-71007959 GAGAGAGGAGAGAGGGAAGAGGG + Intronic
992002159 5:72446358-72446380 CAGACATCCTAGAGGGCAGATGG + Intronic
992116244 5:73540897-73540919 AAGAAAGGAAAGAGGGAAGGAGG + Intergenic
992953825 5:81887759-81887781 CAGACAGGCAAGAGGTACGAGGG + Intergenic
993858072 5:93099945-93099967 CAGGAAGGAAAGAGGGGAGAGGG + Intergenic
993996481 5:94729515-94729537 GAGACTGGGAAAAGGGAAGAAGG - Intronic
995191895 5:109326711-109326733 GAGACAGGAGAGAGGGAAGAAGG + Intergenic
996531643 5:124533548-124533570 CAGCCACTCAGGAGGGAAGAAGG - Intergenic
996578495 5:125002992-125003014 CAGAATGTCAAGAGAGAAGAGGG + Intergenic
996760529 5:126982293-126982315 CAGACATGGTATAGGGAAGATGG - Intronic
996827573 5:127702837-127702859 TGGACAAGCAACAGGGAAGATGG + Intergenic
997142480 5:131397524-131397546 CAGATTGAAAAGAGGGAAGAAGG - Intronic
997174514 5:131760855-131760877 CAGGAGGGAAAGAGGGAAGAAGG + Intronic
997619942 5:135281018-135281040 CAGTCAGGCTAGAGGGAGTATGG - Intronic
998205062 5:140152174-140152196 AAGTGAGGCAAGAGGGATGACGG + Intergenic
998397097 5:141825771-141825793 CCTACAGGCAAGAGGGAAGGGGG + Intergenic
998630408 5:143891835-143891857 CAGACAGGGAAGAGGGGAAAAGG + Intergenic
998722823 5:144974293-144974315 TTGACAGGAAAGAGGGAAAAAGG + Intergenic
999680931 5:154059317-154059339 CAGACAGGGAGAAGGGTAGAAGG + Intronic
1000444244 5:161300539-161300561 AAGACAGGCTAGAGGCAACATGG - Intronic
1001071415 5:168588255-168588277 AAGGCAGGCAAGAGGCAAGAAGG - Intergenic
1001208931 5:169792069-169792091 GAGACTGGCATGAGGGAATAAGG + Intronic
1001445718 5:171781294-171781316 CAGACAGAGAGAAGGGAAGACGG - Intergenic
1001445838 5:171782224-171782246 CAGAAGGACAGGAGGGAAGATGG + Intergenic
1001475094 5:172044778-172044800 CACAGACGCAAGAGGGAAAAGGG + Exonic
1002021623 5:176367380-176367402 CAGACAGGCAATAGTGGAGGAGG - Intronic
1002060971 5:176625875-176625897 CAGACAGGCAAGGGGTGAGAGGG - Intronic
1002400554 5:178989409-178989431 CAGACAGGGAAGAAGGGGGAGGG + Intronic
1002494455 5:179602311-179602333 CAGTCAGGCCAGAGGGAGCAGGG + Intronic
1002957494 6:1881136-1881158 AAAACAGGCAGGAGGGAAGTGGG + Intronic
1003047405 6:2746376-2746398 CATAGAGGAAAGAAGGAAGATGG + Intronic
1003481830 6:6541733-6541755 AAGACGGGAAAGAGGGAAGAGGG - Intergenic
1003696845 6:8415575-8415597 CACATAGTCAAGTGGGAAGATGG - Intronic
1004356367 6:14933052-14933074 GAGACAGGCTAGATGGAAGTTGG - Intergenic
1004482580 6:16035100-16035122 ATGACAGGCAACAGGGAAGTAGG - Intergenic
1004498677 6:16189323-16189345 GAGACAGGCAGGAGGAAACAAGG - Intergenic
1004790386 6:19019745-19019767 AAGACAGAAAAGAGGGAGGAAGG + Intergenic
1005131431 6:22513026-22513048 CAGTGAGCCAAGAGAGAAGATGG + Intergenic
1005361424 6:25034959-25034981 CATTCAGGCAGGAAGGAAGAGGG + Intronic
1005919713 6:30389954-30389976 CAGTCACCCAAGAGGGAAGGTGG - Intergenic
1005942289 6:30569575-30569597 CAAACAGGAAGGAGGCAAGAGGG - Intergenic
1005992965 6:30914731-30914753 GAGACAGGAAAGATGGAACAAGG + Intronic
1006729066 6:36222082-36222104 CAGAGAGGGGAGAGGGGAGAAGG + Intronic
1006744869 6:36334454-36334476 CAGAGAGGAAAGAGAAAAGAAGG - Intronic
1006914911 6:37587925-37587947 GACCCAGGCAAGAGGGAAGCGGG - Intergenic
1006945040 6:37779295-37779317 CTGAGAGGCCAGAGGGAAAAGGG + Intergenic
1007373495 6:41441956-41441978 CAGCCAGGAAGGAGGGAAGGAGG + Intergenic
1007498305 6:42277016-42277038 CAGCCAGCCCAGAGGAAAGATGG - Intronic
1008176629 6:48275966-48275988 CAGAAAGGCAAGAGGGATGTGGG + Intergenic
1008781828 6:55116505-55116527 AAGAAAGGAAAGAGGGAAGAAGG + Intronic
1009375225 6:62960196-62960218 CAAACAGGAAAGAGGAAAGAAGG - Intergenic
1009482909 6:64182859-64182881 CAGCCAGGCGACAGGAAAGAGGG - Intronic
1010253142 6:73729182-73729204 AAGAGAGACAACAGGGAAGAAGG + Intronic
1010800379 6:80168317-80168339 GAGAGAGGGGAGAGGGAAGAAGG + Intronic
1011092714 6:83624540-83624562 CAGAGAAGAAAGAGGAAAGAAGG - Intronic
1011717041 6:90117343-90117365 GAGAGAGGGAAGAGGGAAGAAGG - Intronic
1012222539 6:96666953-96666975 CAGACATGCCAAAGGTAAGATGG + Intergenic
1012224346 6:96687726-96687748 AAGAAAGGCAAGAAGCAAGATGG + Intergenic
1012359678 6:98361724-98361746 CAGTGAGGTCAGAGGGAAGAAGG + Intergenic
1013623080 6:111909246-111909268 CTGAAAGGCAGGAGGGCAGAAGG - Intergenic
1014034746 6:116753345-116753367 GAGACAGGCAAGAGGGACAGTGG + Intronic
1014378130 6:120702780-120702802 AAGAAAGGAAGGAGGGAAGAAGG + Intergenic
1014516168 6:122381167-122381189 CAGACTGGCAAGTTGGAAAAAGG - Intergenic
1015186258 6:130419972-130419994 TAGAAAGGCAAAAGGGATGAAGG + Intronic
1015414496 6:132933176-132933198 CAGACAGACAATAGGGGAAAGGG - Intergenic
1015486503 6:133776064-133776086 CAGAAAGGGAAGAGGGGAAAGGG + Intergenic
1015788674 6:136944560-136944582 CAAAAAGGCAAGTAGGAAGAAGG - Intergenic
1015882558 6:137883636-137883658 AAGACAGGAAAGAGAGAAGTAGG + Intergenic
1015977159 6:138802037-138802059 CGGGCAGGCAAGATGGAAGCCGG - Intronic
1016393336 6:143597010-143597032 CAGAAACGCAGGAGGGAAGGAGG - Intronic
1016869685 6:148804354-148804376 CAGACAGACAACAGGGGATATGG - Intronic
1017324102 6:153127479-153127501 CAGACATACAAGAGGGATGAAGG - Intronic
1017380860 6:153827592-153827614 CAGTGAGGCAAGAGAGAACAAGG - Intergenic
1017751793 6:157495538-157495560 CAGAGAGGCATGAGGGAAGGAGG + Intronic
1018772330 6:166982194-166982216 GAGAAAGGAAAGAAGGAAGAAGG - Intergenic
1019065666 6:169294523-169294545 CAGACAGGAAAGAGCGCACATGG - Intergenic
1019205728 6:170360050-170360072 CTGACAGGGAAGAGGGGAGCAGG - Intronic
1019273563 7:164192-164214 CAGACAGGCAGGAGGCACGCAGG + Intergenic
1020139361 7:5604204-5604226 CACACAGACAAGAGGGAAAGGGG - Intronic
1020317408 7:6915996-6916018 CAAACAGACAAGAGGGAGAAGGG + Intergenic
1020677511 7:11198697-11198719 AAGACAGGGAAAGGGGAAGAGGG - Intergenic
1021292858 7:18867150-18867172 CATGCAGGGAAGAAGGAAGAGGG + Intronic
1021614946 7:22492793-22492815 CACACAGGGAAGAGTGTAGAAGG - Intronic
1021626894 7:22602417-22602439 CAGACAGGGAAGTGGGGGGATGG + Intronic
1022059912 7:26783295-26783317 AATAAAGGCAGGAGGGAAGAAGG - Intronic
1022136841 7:27457207-27457229 CACACAGGCAACAGGGATGGGGG + Intergenic
1022180297 7:27912558-27912580 CAGAGAGGGAGGAAGGAAGAGGG + Intronic
1022190447 7:28012580-28012602 AAGACAGATAGGAGGGAAGAGGG + Intronic
1022520792 7:31005667-31005689 GAGACAGGAAGGAGAGAAGAGGG + Intergenic
1022661728 7:32374059-32374081 TAGGCAGGAAAGAGGGAGGAGGG + Intergenic
1022743437 7:33145515-33145537 TAGAAAGGCAAGATAGAAGAGGG - Intronic
1023199870 7:37685354-37685376 CAGGCAGGCAGGAAGGAAGGAGG - Intronic
1023712879 7:43013622-43013644 CAGACAGGCAGCAGGTAATAAGG - Intergenic
1023760734 7:43462891-43462913 CAGACAGGCAAGAGGTATGTGGG - Intronic
1023921238 7:44631830-44631852 GAGAAAGGAAAGAGGGAAGGGGG - Intronic
1024051519 7:45626808-45626830 CAGCCAGGCAGGAAGGAGGACGG + Intronic
1024334686 7:48195449-48195471 CAGACATGAAGGAGGTAAGATGG + Intronic
1024803479 7:53108430-53108452 CAGACAAGCAGGAGGGCAGGAGG + Intergenic
1025796216 7:64739624-64739646 GGGAGAGGGAAGAGGGAAGAGGG + Intergenic
1026070462 7:67114393-67114415 CAGAAAGGCAACATGGGAGAGGG + Intronic
1026107488 7:67432712-67432734 CAGGCAGGCAGTAGGGAAAAGGG - Intergenic
1026231178 7:68485392-68485414 AAGAAAGGGAAGAGGGAGGAAGG + Intergenic
1026364352 7:69632601-69632623 CAGAGAGGGAAGAGGGGAGAGGG - Intronic
1026390276 7:69894297-69894319 GAGAAAGGCAGGAGGGCAGAAGG - Intronic
1026509161 7:71013682-71013704 CAGACAGAAAGGAGGGAGGAAGG + Intergenic
1026706437 7:72697885-72697907 CAGAAAGGCAACATGGGAGAGGG - Intronic
1026809568 7:73451529-73451551 CAGACTGGGGAGAGGGATGAGGG + Intronic
1026815132 7:73505047-73505069 CAGGCTGGCAAGAGAGAAGAGGG - Intronic
1026889857 7:73975361-73975383 CAGGCAAACAATAGGGAAGACGG - Intergenic
1026914259 7:74110460-74110482 CAGACAGGTAAGAGGTAGAAGGG - Intronic
1026926299 7:74196242-74196264 CACACAGGCAACAGGGATGGGGG - Exonic
1027433751 7:78141784-78141806 CAGACAGGAGAATGGGAAGAAGG + Intronic
1027463952 7:78491230-78491252 AAGCCAGGAAAGAGGGAGGATGG + Intronic
1027529492 7:79312910-79312932 CATACAAGCTAAAGGGAAGAAGG - Intronic
1028463348 7:91120932-91120954 CAGAAAAGCTACAGGGAAGATGG + Intronic
1030338548 7:108351192-108351214 CAGAAGGGCAAGAGAGAGGAGGG - Intronic
1030647159 7:112074608-112074630 CAGACAGACAAGAGGCAAAATGG - Intronic
1030722180 7:112883301-112883323 GAGACAGACAAAAGGAAAGAAGG - Intronic
1031029213 7:116716254-116716276 CAAGCAAGCAAGAGGGAAGGAGG + Intronic
1031561246 7:123241303-123241325 CCAATAGGCAAGAGAGAAGAGGG - Intergenic
1031642550 7:124182231-124182253 GAGATAGGCAAGAGAGAAGGGGG + Intergenic
1031685737 7:124730599-124730621 GGGACAGGCGGGAGGGAAGAAGG - Intergenic
1031813587 7:126404171-126404193 CAGCCAGAGAAGAAGGAAGAAGG - Intergenic
1032083620 7:128872544-128872566 CAGACAGCCAGGAGGGCAGGGGG - Intronic
1032414646 7:131726693-131726715 GAGACAGGGAAGAGGGAAGAGGG + Intergenic
1032453135 7:132051888-132051910 CAGGGAGGCAAGAGGACAGACGG + Intergenic
1032598503 7:133267543-133267565 AAGACAGGCAAGGAGGAAGGAGG - Intronic
1032704473 7:134410211-134410233 CAGACAGGCATCAGGGAAGGGGG - Intergenic
1032908114 7:136396117-136396139 CAGGCAGGAAGGAAGGAAGAAGG + Intergenic
1032961682 7:137042489-137042511 GAGAGAGAGAAGAGGGAAGAGGG - Intergenic
1033009393 7:137604220-137604242 TAGGCAGGGAAGAGGGCAGAGGG - Intronic
1033015533 7:137667309-137667331 CAGACAGACTTGAGTGAAGATGG + Intronic
1033194903 7:139319425-139319447 CAGGCAGCCAAAAGGAAAGAAGG - Intergenic
1033236593 7:139642714-139642736 CAGACAAGCAAAAGGAAAAAGGG + Intronic
1033256581 7:139806748-139806770 CAGACAGATGAGAGGGAGGATGG - Intronic
1033359274 7:140626619-140626641 CAGGAAGGCAAGAGGGAGAAAGG - Intronic
1035203499 7:157280580-157280602 CGGGCAGGCAGGAGGGAGGAAGG + Intergenic
1035596195 8:859837-859859 CAGGCAGCCGAGATGGAAGACGG + Intergenic
1036636123 8:10550640-10550662 CAGGCAGGCAGGAGAGAGGAAGG - Intronic
1036726500 8:11225390-11225412 TCGAAAGGCAGGAGGGAAGATGG - Intergenic
1037591736 8:20318073-20318095 GAGAGAAGGAAGAGGGAAGAGGG - Intergenic
1037672661 8:21028623-21028645 CAGAAAGGAAAGAGGGAGAAGGG + Intergenic
1037831358 8:22191646-22191668 AGGAGAGGCAAGAGGAAAGAAGG - Intronic
1038040239 8:23718049-23718071 CAGAAAGGCACTAGGTAAGAAGG - Intergenic
1038400331 8:27279656-27279678 TAGACAGGGGAGAGGGAGGAAGG + Intergenic
1039058360 8:33554414-33554436 CAGCCAGACAAGAGGCATGATGG - Intronic
1039215794 8:35269313-35269335 CAGAGAGACAGGAAGGAAGATGG - Intronic
1039404784 8:37303170-37303192 CAGACAGGCACGAAGGAGGGTGG + Intergenic
1039832102 8:41223616-41223638 CAGAGAGCCAAGAGGGAGGAAGG + Intergenic
1040326437 8:46344005-46344027 GAGACAGGCAAAGGGGAAAAGGG + Intergenic
1041167834 8:55108194-55108216 CAGAGAGGCAAGAAAGAACAAGG + Intronic
1041687913 8:60661123-60661145 CAGCCAAGGAAGAGGGAAGGAGG - Intergenic
1041746835 8:61216387-61216409 CAGACAGACTAGAGGGTGGATGG - Intronic
1041796893 8:61754345-61754367 CAGAGAGGAAAGAGGGAGGAGGG - Intergenic
1042092295 8:65172155-65172177 AAGATAAGCAAGAGGTAAGATGG - Intergenic
1042133848 8:65616147-65616169 GAGACCGGGAAGAGGGGAGAGGG - Intronic
1042165752 8:65944416-65944438 GAGACAGGAAAGAGAGAACAAGG + Intergenic
1042204238 8:66312418-66312440 CACACAGGAAAGAAGTAAGAGGG + Intergenic
1043260471 8:78188442-78188464 GAGACAGGAAAGAAGGAAGGGGG + Intergenic
1043917130 8:85936168-85936190 TTGACAGGCAATGGGGAAGAAGG - Intergenic
1044045501 8:87426327-87426349 CAAACAGGGAAGAGCCAAGATGG - Intronic
1044357062 8:91234868-91234890 GAGAAAGGAAGGAGGGAAGAAGG - Intronic
1044387404 8:91605649-91605671 CAGAAAGGCAAGTGGGAATGCGG - Intergenic
1044429821 8:92095662-92095684 GACACAGGCAGGAGGGAAGGAGG + Intronic
1044480530 8:92682120-92682142 CTGACAGGCCTGAGGGAAGCCGG + Intergenic
1045127146 8:99104620-99104642 CAAAAAGGAAAGGGGGAAGAGGG - Intronic
1046324012 8:112616716-112616738 CAAACAGGCCAGATGGCAGATGG + Intronic
1047284252 8:123472908-123472930 ATGAAAGGAAAGAGGGAAGAGGG - Intergenic
1047399869 8:124537315-124537337 CAGACAGGCAACAGGGTAGTTGG + Intronic
1047642053 8:126831530-126831552 CAGAAAAGCAGGAGGAAAGAGGG - Intergenic
1048089044 8:131218718-131218740 CAGGTAGGCAAGAGAAAAGAAGG + Intergenic
1048680602 8:136837366-136837388 AAGAAAGAAAAGAGGGAAGAGGG - Intergenic
1049205689 8:141362468-141362490 CATTCAGACAAGGGGGAAGACGG - Intronic
1049293948 8:141819866-141819888 CAGACAGGCAAGAGCGGCAAAGG + Intergenic
1049362541 8:142219244-142219266 CAGACAGGCAGGAGGAAGGAGGG + Intronic
1049377028 8:142294149-142294171 CAGAGTGGCCAGAGGGAAGGTGG + Intronic
1049469565 8:142769323-142769345 TTCCCAGGCAAGAGGGAAGAGGG + Intronic
1049702443 8:144021300-144021322 CAGAGGGTCATGAGGGAAGAGGG - Intronic
1050028723 9:1363095-1363117 CAGACAAGCTACATGGAAGAAGG - Intergenic
1050562918 9:6852974-6852996 CACACAGGCAAGCTGGAGGATGG - Intronic
1050640274 9:7660234-7660256 CAGACAGGTAAGAGTGATAAGGG - Intergenic
1050937218 9:11413720-11413742 CAGACAGGCACCTGGGCAGAAGG + Intergenic
1051187898 9:14479961-14479983 AAGACAGGAAGGAAGGAAGAAGG + Intergenic
1051292745 9:15561882-15561904 CAGGCAGGTAAGAAGGAAAATGG - Intronic
1051386624 9:16516106-16516128 CCGAAAGGCAAGAGGGCATAAGG - Intronic
1051457189 9:17272050-17272072 CAGAAAGGAAAGAGAGAGGAAGG - Intronic
1052067517 9:24040566-24040588 CACAGAGCAAAGAGGGAAGATGG - Intergenic
1052331319 9:27271758-27271780 AAGTCATCCAAGAGGGAAGAAGG + Intergenic
1053621888 9:39828037-39828059 CAGAGAGAGAAGGGGGAAGATGG - Intergenic
1053837821 9:42159895-42159917 CAGAGAGAGAAGGGGGAAGATGG - Intergenic
1053883197 9:42616235-42616257 CAGAGAGAGAAGGGGGAAGATGG + Intergenic
1053889472 9:42678064-42678086 CAGAGAGAGAAGGGGGAAGATGG - Intergenic
1054140709 9:61527310-61527332 CAGTTAGACAAGAGGAAAGAAGG - Intergenic
1054222221 9:62423708-62423730 CAGAGAGAGAAGGGGGAAGATGG + Intergenic
1054228492 9:62485464-62485486 CAGAGAGAGAAGGGGGAAGATGG - Intergenic
1055437874 9:76310628-76310650 AATTCAGGGAAGAGGGAAGATGG - Intronic
1056122811 9:83505951-83505973 GAGAAATGCAAAAGGGAAGATGG + Intronic
1057108778 9:92447151-92447173 CGGACAGGCATGAGGGAGGAAGG + Intronic
1057307889 9:93922756-93922778 AAGACAGAGAAGAAGGAAGAGGG + Intergenic
1057794554 9:98146099-98146121 TAGACAGGCCAGAGGGGACATGG - Intronic
1058272945 9:102997771-102997793 GTTACAGGCAAGAGGAAAGATGG + Intronic
1058388031 9:104461496-104461518 GAAACAGGTAAGAGAGAAGAAGG + Intergenic
1058395556 9:104549574-104549596 CAGAAAGGCAAAAGAGCAGAAGG - Intergenic
1058843608 9:108934254-108934276 CAGATGGGCAAGAGGGCAGAGGG - Exonic
1059613790 9:115927147-115927169 CTGACAGCCATCAGGGAAGATGG + Intergenic
1059735301 9:117094215-117094237 AGGAAAGGAAAGAGGGAAGAAGG + Intronic
1060049238 9:120365599-120365621 CAGAAAGGAGAGAGAGAAGAGGG + Intergenic
1060244389 9:121931860-121931882 GAGAAAGGCATGAAGGAAGATGG - Intronic
1061034864 9:128107846-128107868 CAGACAGGCAGGCAGCAAGAGGG - Exonic
1061077008 9:128347917-128347939 CTGAAAGGGGAGAGGGAAGAAGG + Intronic
1061281959 9:129602666-129602688 CAGACAGGAAGGAGGGAGGGAGG + Intergenic
1061989807 9:134152728-134152750 ATGACAGACTAGAGGGAAGAAGG - Intronic
1062097947 9:134712366-134712388 GAGACAGGAAGGAGGGAAGAAGG - Intronic
1062183841 9:135205764-135205786 CAGACCTGCACGAAGGAAGAAGG + Intergenic
1062443159 9:136582519-136582541 GAGACAGGAAAAAGGGAGGAAGG + Intergenic
1062573411 9:137195699-137195721 CAGAGAGCCAAGAGGGGAGGAGG + Intronic
1185648055 X:1629060-1629082 AAGAAAGGAAAGAAGGAAGAAGG - Intronic
1185924403 X:4130669-4130691 CTGAGATGCAAGAGGGAGGAAGG - Intergenic
1185954880 X:4478380-4478402 AAGGGAGGAAAGAGGGAAGAAGG + Intergenic
1186874930 X:13807410-13807432 GAAAGAGGGAAGAGGGAAGAAGG + Intronic
1186944044 X:14545307-14545329 CAGAAGGGCAAGAGGGCATAAGG + Intronic
1186967332 X:14802206-14802228 CAGTCAGACAAGGGGGAGGAAGG + Intergenic
1187539620 X:20179402-20179424 CAGTCAGGAAAGAGTGCAGAGGG + Intronic
1187940448 X:24375858-24375880 CAGACAGGGAAGTGGGGAGGGGG + Intergenic
1188161144 X:26804736-26804758 AAGATAGGAAATAGGGAAGAAGG - Intergenic
1188442845 X:30230369-30230391 CAGAGAGGCAAGAGAAAATAAGG + Intergenic
1189200977 X:39195391-39195413 CAGACAGGCAGGAGGCAGGAGGG + Intergenic
1190128361 X:47724964-47724986 CACACAAGGAGGAGGGAAGAGGG - Intergenic
1190153038 X:47964568-47964590 CAGAAGGGGGAGAGGGAAGAGGG + Intronic
1190363983 X:49674606-49674628 AAGATATGCAAGAGGGAAGCTGG - Intergenic
1190756450 X:53405774-53405796 CAGGTAGTCAAGAGGCAAGAAGG + Exonic
1192089819 X:68141961-68141983 AAGAGAGGCAAGAGCCAAGACGG + Intronic
1192436657 X:71147536-71147558 CAGACAGGCCTGTGGAAAGAGGG - Exonic
1192678506 X:73226091-73226113 CAGAATGGCAGGTGGGAAGATGG - Intergenic
1194198062 X:90920504-90920526 TAGACAGGCAAAAGGGCAAAAGG - Intergenic
1195234526 X:102883586-102883608 GAGAAAGGCAAGAGGACAGAGGG + Intergenic
1196384011 X:115128197-115128219 GAGGCAGGCAAGAGAAAAGAGGG + Intronic
1196827372 X:119751470-119751492 AAGGCAGGCATGAGGGAAGAGGG - Intergenic
1198770312 X:140123864-140123886 CAGAGAGGCAAAAGGAAAGATGG - Intergenic
1198859733 X:141056381-141056403 AAGACAGGCTAGAGGCATGAAGG - Intergenic
1198902960 X:141531009-141531031 AAGACAGGCTAGAGGCATGAAGG + Intergenic
1199849109 X:151712595-151712617 CAGACAGACACAAGGGCAGATGG + Intergenic
1200125447 X:153811802-153811824 TAGAAAGGCAGGATGGAAGAGGG + Intronic
1200150354 X:153948320-153948342 AGGACAGGCAAAAGGGCAGAGGG + Exonic
1200543679 Y:4492327-4492349 TAGACAGGCAAAAGGGCAAAAGG + Intergenic
1201023489 Y:9682153-9682175 CAGACAGGGAGAAGGGAAGGAGG - Intergenic
1201711882 Y:17001337-17001359 CAGACAAGTAGGAGGGAGGAAGG - Intergenic