ID: 1074300904

View in Genome Browser
Species Human (GRCh38)
Location 10:112232577-112232599
Sequence CAGAGGGAATGGAGATAAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074300900_1074300904 -6 Left 1074300900 10:112232560-112232582 CCTGGACTCGAGGGTGTCAGAGG No data
Right 1074300904 10:112232577-112232599 CAGAGGGAATGGAGATAAGTAGG No data
1074300899_1074300904 0 Left 1074300899 10:112232554-112232576 CCAGGGCCTGGACTCGAGGGTGT No data
Right 1074300904 10:112232577-112232599 CAGAGGGAATGGAGATAAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074300904 Original CRISPR CAGAGGGAATGGAGATAAGT AGG Intergenic
No off target data available for this crispr