ID: 1074301916

View in Genome Browser
Species Human (GRCh38)
Location 10:112240779-112240801
Sequence GGGCTCTTTCCCCACAGGCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074301916_1074301918 -10 Left 1074301916 10:112240779-112240801 CCGAGCCTGTGGGGAAAGAGCCC No data
Right 1074301918 10:112240792-112240814 GAAAGAGCCCACAAGAGCGCAGG No data
1074301916_1074301926 13 Left 1074301916 10:112240779-112240801 CCGAGCCTGTGGGGAAAGAGCCC No data
Right 1074301926 10:112240815-112240837 GATGCTCAGGTCGGGAGCCAGGG No data
1074301916_1074301929 21 Left 1074301916 10:112240779-112240801 CCGAGCCTGTGGGGAAAGAGCCC No data
Right 1074301929 10:112240823-112240845 GGTCGGGAGCCAGGGCTGGGCGG No data
1074301916_1074301928 18 Left 1074301916 10:112240779-112240801 CCGAGCCTGTGGGGAAAGAGCCC No data
Right 1074301928 10:112240820-112240842 TCAGGTCGGGAGCCAGGGCTGGG No data
1074301916_1074301919 -9 Left 1074301916 10:112240779-112240801 CCGAGCCTGTGGGGAAAGAGCCC No data
Right 1074301919 10:112240793-112240815 AAAGAGCCCACAAGAGCGCAGGG No data
1074301916_1074301927 17 Left 1074301916 10:112240779-112240801 CCGAGCCTGTGGGGAAAGAGCCC No data
Right 1074301927 10:112240819-112240841 CTCAGGTCGGGAGCCAGGGCTGG No data
1074301916_1074301923 4 Left 1074301916 10:112240779-112240801 CCGAGCCTGTGGGGAAAGAGCCC No data
Right 1074301923 10:112240806-112240828 GAGCGCAGGGATGCTCAGGTCGG No data
1074301916_1074301922 0 Left 1074301916 10:112240779-112240801 CCGAGCCTGTGGGGAAAGAGCCC No data
Right 1074301922 10:112240802-112240824 ACAAGAGCGCAGGGATGCTCAGG No data
1074301916_1074301924 5 Left 1074301916 10:112240779-112240801 CCGAGCCTGTGGGGAAAGAGCCC No data
Right 1074301924 10:112240807-112240829 AGCGCAGGGATGCTCAGGTCGGG No data
1074301916_1074301931 30 Left 1074301916 10:112240779-112240801 CCGAGCCTGTGGGGAAAGAGCCC No data
Right 1074301931 10:112240832-112240854 CCAGGGCTGGGCGGCAGCAGCGG No data
1074301916_1074301925 12 Left 1074301916 10:112240779-112240801 CCGAGCCTGTGGGGAAAGAGCCC No data
Right 1074301925 10:112240814-112240836 GGATGCTCAGGTCGGGAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074301916 Original CRISPR GGGCTCTTTCCCCACAGGCT CGG (reversed) Intergenic