ID: 1074301917

View in Genome Browser
Species Human (GRCh38)
Location 10:112240784-112240806
Sequence CTTGTGGGCTCTTTCCCCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074301917_1074301924 0 Left 1074301917 10:112240784-112240806 CCTGTGGGGAAAGAGCCCACAAG No data
Right 1074301924 10:112240807-112240829 AGCGCAGGGATGCTCAGGTCGGG No data
1074301917_1074301925 7 Left 1074301917 10:112240784-112240806 CCTGTGGGGAAAGAGCCCACAAG No data
Right 1074301925 10:112240814-112240836 GGATGCTCAGGTCGGGAGCCAGG No data
1074301917_1074301922 -5 Left 1074301917 10:112240784-112240806 CCTGTGGGGAAAGAGCCCACAAG No data
Right 1074301922 10:112240802-112240824 ACAAGAGCGCAGGGATGCTCAGG No data
1074301917_1074301929 16 Left 1074301917 10:112240784-112240806 CCTGTGGGGAAAGAGCCCACAAG No data
Right 1074301929 10:112240823-112240845 GGTCGGGAGCCAGGGCTGGGCGG No data
1074301917_1074301923 -1 Left 1074301917 10:112240784-112240806 CCTGTGGGGAAAGAGCCCACAAG No data
Right 1074301923 10:112240806-112240828 GAGCGCAGGGATGCTCAGGTCGG No data
1074301917_1074301931 25 Left 1074301917 10:112240784-112240806 CCTGTGGGGAAAGAGCCCACAAG No data
Right 1074301931 10:112240832-112240854 CCAGGGCTGGGCGGCAGCAGCGG No data
1074301917_1074301928 13 Left 1074301917 10:112240784-112240806 CCTGTGGGGAAAGAGCCCACAAG No data
Right 1074301928 10:112240820-112240842 TCAGGTCGGGAGCCAGGGCTGGG No data
1074301917_1074301927 12 Left 1074301917 10:112240784-112240806 CCTGTGGGGAAAGAGCCCACAAG No data
Right 1074301927 10:112240819-112240841 CTCAGGTCGGGAGCCAGGGCTGG No data
1074301917_1074301926 8 Left 1074301917 10:112240784-112240806 CCTGTGGGGAAAGAGCCCACAAG No data
Right 1074301926 10:112240815-112240837 GATGCTCAGGTCGGGAGCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074301917 Original CRISPR CTTGTGGGCTCTTTCCCCAC AGG (reversed) Intergenic
No off target data available for this crispr