ID: 1074301920

View in Genome Browser
Species Human (GRCh38)
Location 10:112240799-112240821
Sequence GAGCATCCCTGCGCTCTTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074301920_1074301927 -3 Left 1074301920 10:112240799-112240821 CCCACAAGAGCGCAGGGATGCTC No data
Right 1074301927 10:112240819-112240841 CTCAGGTCGGGAGCCAGGGCTGG No data
1074301920_1074301931 10 Left 1074301920 10:112240799-112240821 CCCACAAGAGCGCAGGGATGCTC No data
Right 1074301931 10:112240832-112240854 CCAGGGCTGGGCGGCAGCAGCGG No data
1074301920_1074301933 25 Left 1074301920 10:112240799-112240821 CCCACAAGAGCGCAGGGATGCTC No data
Right 1074301933 10:112240847-112240869 AGCAGCGGTGCCCAGGAGCATGG No data
1074301920_1074301932 18 Left 1074301920 10:112240799-112240821 CCCACAAGAGCGCAGGGATGCTC No data
Right 1074301932 10:112240840-112240862 GGGCGGCAGCAGCGGTGCCCAGG No data
1074301920_1074301934 26 Left 1074301920 10:112240799-112240821 CCCACAAGAGCGCAGGGATGCTC No data
Right 1074301934 10:112240848-112240870 GCAGCGGTGCCCAGGAGCATGGG No data
1074301920_1074301929 1 Left 1074301920 10:112240799-112240821 CCCACAAGAGCGCAGGGATGCTC No data
Right 1074301929 10:112240823-112240845 GGTCGGGAGCCAGGGCTGGGCGG No data
1074301920_1074301926 -7 Left 1074301920 10:112240799-112240821 CCCACAAGAGCGCAGGGATGCTC No data
Right 1074301926 10:112240815-112240837 GATGCTCAGGTCGGGAGCCAGGG No data
1074301920_1074301925 -8 Left 1074301920 10:112240799-112240821 CCCACAAGAGCGCAGGGATGCTC No data
Right 1074301925 10:112240814-112240836 GGATGCTCAGGTCGGGAGCCAGG No data
1074301920_1074301928 -2 Left 1074301920 10:112240799-112240821 CCCACAAGAGCGCAGGGATGCTC No data
Right 1074301928 10:112240820-112240842 TCAGGTCGGGAGCCAGGGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074301920 Original CRISPR GAGCATCCCTGCGCTCTTGT GGG (reversed) Intergenic
No off target data available for this crispr