ID: 1074301925

View in Genome Browser
Species Human (GRCh38)
Location 10:112240814-112240836
Sequence GGATGCTCAGGTCGGGAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074301917_1074301925 7 Left 1074301917 10:112240784-112240806 CCTGTGGGGAAAGAGCCCACAAG No data
Right 1074301925 10:112240814-112240836 GGATGCTCAGGTCGGGAGCCAGG No data
1074301920_1074301925 -8 Left 1074301920 10:112240799-112240821 CCCACAAGAGCGCAGGGATGCTC No data
Right 1074301925 10:112240814-112240836 GGATGCTCAGGTCGGGAGCCAGG No data
1074301921_1074301925 -9 Left 1074301921 10:112240800-112240822 CCACAAGAGCGCAGGGATGCTCA No data
Right 1074301925 10:112240814-112240836 GGATGCTCAGGTCGGGAGCCAGG No data
1074301916_1074301925 12 Left 1074301916 10:112240779-112240801 CCGAGCCTGTGGGGAAAGAGCCC No data
Right 1074301925 10:112240814-112240836 GGATGCTCAGGTCGGGAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074301925 Original CRISPR GGATGCTCAGGTCGGGAGCC AGG Intergenic
No off target data available for this crispr