ID: 1074301934

View in Genome Browser
Species Human (GRCh38)
Location 10:112240848-112240870
Sequence GCAGCGGTGCCCAGGAGCAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074301921_1074301934 25 Left 1074301921 10:112240800-112240822 CCACAAGAGCGCAGGGATGCTCA No data
Right 1074301934 10:112240848-112240870 GCAGCGGTGCCCAGGAGCATGGG No data
1074301930_1074301934 -7 Left 1074301930 10:112240832-112240854 CCAGGGCTGGGCGGCAGCAGCGG No data
Right 1074301934 10:112240848-112240870 GCAGCGGTGCCCAGGAGCATGGG No data
1074301920_1074301934 26 Left 1074301920 10:112240799-112240821 CCCACAAGAGCGCAGGGATGCTC No data
Right 1074301934 10:112240848-112240870 GCAGCGGTGCCCAGGAGCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074301934 Original CRISPR GCAGCGGTGCCCAGGAGCAT GGG Intergenic
No off target data available for this crispr