ID: 1074309947

View in Genome Browser
Species Human (GRCh38)
Location 10:112313511-112313533
Sequence CAGCACTGACCACAATCCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074309947_1074309951 1 Left 1074309947 10:112313511-112313533 CCCTGGGATTGTGGTCAGTGCTG No data
Right 1074309951 10:112313535-112313557 TGCACTTGTGGCTGCCCACCAGG No data
1074309947_1074309956 24 Left 1074309947 10:112313511-112313533 CCCTGGGATTGTGGTCAGTGCTG No data
Right 1074309956 10:112313558-112313580 CATGTATGAGCACAGGCACACGG No data
1074309947_1074309954 17 Left 1074309947 10:112313511-112313533 CCCTGGGATTGTGGTCAGTGCTG No data
Right 1074309954 10:112313551-112313573 CACCAGGCATGTATGAGCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074309947 Original CRISPR CAGCACTGACCACAATCCCA GGG (reversed) Intergenic
No off target data available for this crispr