ID: 1074313375

View in Genome Browser
Species Human (GRCh38)
Location 10:112341404-112341426
Sequence ATGAGAAATGTCTCCAGACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074313375_1074313377 -10 Left 1074313375 10:112341404-112341426 CCATGTCTGGAGACATTTCTCAT No data
Right 1074313377 10:112341417-112341439 CATTTCTCATTCCGACTAGAGGG No data
1074313375_1074313383 21 Left 1074313375 10:112341404-112341426 CCATGTCTGGAGACATTTCTCAT No data
Right 1074313383 10:112341448-112341470 GGCATCTGTGGGTAGAGGCCAGG No data
1074313375_1074313382 16 Left 1074313375 10:112341404-112341426 CCATGTCTGGAGACATTTCTCAT No data
Right 1074313382 10:112341443-112341465 CTATAGGCATCTGTGGGTAGAGG No data
1074313375_1074313381 10 Left 1074313375 10:112341404-112341426 CCATGTCTGGAGACATTTCTCAT No data
Right 1074313381 10:112341437-112341459 GGGCTGCTATAGGCATCTGTGGG No data
1074313375_1074313385 23 Left 1074313375 10:112341404-112341426 CCATGTCTGGAGACATTTCTCAT No data
Right 1074313385 10:112341450-112341472 CATCTGTGGGTAGAGGCCAGGGG No data
1074313375_1074313380 9 Left 1074313375 10:112341404-112341426 CCATGTCTGGAGACATTTCTCAT No data
Right 1074313380 10:112341436-112341458 AGGGCTGCTATAGGCATCTGTGG No data
1074313375_1074313378 0 Left 1074313375 10:112341404-112341426 CCATGTCTGGAGACATTTCTCAT No data
Right 1074313378 10:112341427-112341449 TCCGACTAGAGGGCTGCTATAGG No data
1074313375_1074313384 22 Left 1074313375 10:112341404-112341426 CCATGTCTGGAGACATTTCTCAT No data
Right 1074313384 10:112341449-112341471 GCATCTGTGGGTAGAGGCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074313375 Original CRISPR ATGAGAAATGTCTCCAGACA TGG (reversed) Intergenic
No off target data available for this crispr