ID: 1074313862

View in Genome Browser
Species Human (GRCh38)
Location 10:112344594-112344616
Sequence GAGTCATCCCACTTTGGTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074313862_1074313865 -10 Left 1074313862 10:112344594-112344616 CCAGAACCAAAGTGGGATGACTC No data
Right 1074313865 10:112344607-112344629 GGGATGACTCAGGCTCTTAAAGG No data
1074313862_1074313866 -9 Left 1074313862 10:112344594-112344616 CCAGAACCAAAGTGGGATGACTC No data
Right 1074313866 10:112344608-112344630 GGATGACTCAGGCTCTTAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074313862 Original CRISPR GAGTCATCCCACTTTGGTTC TGG (reversed) Intergenic
No off target data available for this crispr