ID: 1074317841

View in Genome Browser
Species Human (GRCh38)
Location 10:112375470-112375492
Sequence CAGGAAGTTCAGCATGATCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 219
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 193}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074317841_1074317843 -9 Left 1074317841 10:112375470-112375492 CCAGGATCATGCTGAACTTCCTG 0: 1
1: 0
2: 1
3: 24
4: 193
Right 1074317843 10:112375484-112375506 AACTTCCTGTGAGCCTTCGTGGG 0: 1
1: 0
2: 0
3: 4
4: 93
1074317841_1074317845 -7 Left 1074317841 10:112375470-112375492 CCAGGATCATGCTGAACTTCCTG 0: 1
1: 0
2: 1
3: 24
4: 193
Right 1074317845 10:112375486-112375508 CTTCCTGTGAGCCTTCGTGGGGG 0: 1
1: 0
2: 1
3: 16
4: 144
1074317841_1074317847 0 Left 1074317841 10:112375470-112375492 CCAGGATCATGCTGAACTTCCTG 0: 1
1: 0
2: 1
3: 24
4: 193
Right 1074317847 10:112375493-112375515 TGAGCCTTCGTGGGGGATCGAGG 0: 1
1: 0
2: 0
3: 6
4: 58
1074317841_1074317842 -10 Left 1074317841 10:112375470-112375492 CCAGGATCATGCTGAACTTCCTG 0: 1
1: 0
2: 1
3: 24
4: 193
Right 1074317842 10:112375483-112375505 GAACTTCCTGTGAGCCTTCGTGG 0: 1
1: 0
2: 0
3: 5
4: 83
1074317841_1074317849 4 Left 1074317841 10:112375470-112375492 CCAGGATCATGCTGAACTTCCTG 0: 1
1: 0
2: 1
3: 24
4: 193
Right 1074317849 10:112375497-112375519 CCTTCGTGGGGGATCGAGGCTGG 0: 1
1: 0
2: 0
3: 4
4: 113
1074317841_1074317850 28 Left 1074317841 10:112375470-112375492 CCAGGATCATGCTGAACTTCCTG 0: 1
1: 0
2: 1
3: 24
4: 193
Right 1074317850 10:112375521-112375543 GAAAGTGCTGCTTCATTCTGAGG 0: 1
1: 0
2: 2
3: 14
4: 218
1074317841_1074317844 -8 Left 1074317841 10:112375470-112375492 CCAGGATCATGCTGAACTTCCTG 0: 1
1: 0
2: 1
3: 24
4: 193
Right 1074317844 10:112375485-112375507 ACTTCCTGTGAGCCTTCGTGGGG 0: 1
1: 0
2: 0
3: 8
4: 75

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074317841 Original CRISPR CAGGAAGTTCAGCATGATCC TGG (reversed) Intronic
900141073 1:1139693-1139715 CAGGAAGCTCCCCATGACCCAGG - Intergenic
900141236 1:1140181-1140203 CAGGAAGCTCCCCATGACCCAGG - Intergenic
900204500 1:1426285-1426307 CAGGAGGTGCAGCAGGAGCCCGG - Exonic
900430312 1:2598282-2598304 CAGGTAGTTCTGTATGGTCCTGG + Exonic
903405051 1:23088978-23089000 CAGGCAGTTCAGACGGATCCAGG + Exonic
915600886 1:156922699-156922721 CAGCAACTTCAGCATCATCTGGG + Intronic
918269538 1:182884061-182884083 CAGGAAGTTCAAGATCAGCCTGG + Intronic
924405393 1:243739815-243739837 GACAAAGTTCAGCATGTTCCGGG - Intronic
1063502333 10:6566545-6566567 CTGGAAGGTGAGCATGACCCTGG + Intronic
1063697220 10:8348490-8348512 CAGGAAGACTAGCATCATCCAGG + Intergenic
1064835094 10:19517690-19517712 TATGAAGTTCAGTATGAGCCTGG + Intronic
1067088548 10:43255167-43255189 CAGGAAGGACAGCAGGATCCAGG + Intronic
1067223661 10:44361788-44361810 GAGGAAGTACAGCAAGAACCTGG + Intergenic
1067730403 10:48806363-48806385 CAGGAAGTGAGGCAGGATCCCGG - Intronic
1069292161 10:66793350-66793372 CCAGAAGTTCAGCATCAGCCTGG - Intronic
1069961899 10:72084077-72084099 CAGGGACTTCACCATGATCCTGG - Intronic
1071583328 10:86793913-86793935 CAGGAAGGGGAGCCTGATCCAGG - Intronic
1071863785 10:89703317-89703339 TAGGAATTTCAGCCTGATCAAGG + Intronic
1072755435 10:98017744-98017766 CAGGAAGTTCAAGATCAGCCTGG - Intronic
1074317841 10:112375470-112375492 CAGGAAGTTCAGCATGATCCTGG - Intronic
1075744217 10:124715384-124715406 CAGGAAGCTCAGGGTGCTCCTGG + Intronic
1077905955 11:6533655-6533677 CAGGAATTACAGCATGAGACCGG - Intronic
1080933251 11:36836296-36836318 AAGGAAGTTCATCAAGATCAAGG - Intergenic
1081972191 11:47207092-47207114 CAGGAAGTTCAAGACCATCCTGG + Intergenic
1083591063 11:63895191-63895213 CAGTAAGTCCAACATGATTCGGG + Exonic
1084724965 11:70935530-70935552 TGGAAAGTTCAGCATGACCCAGG - Intronic
1084781726 11:71414204-71414226 CAGGAAGTTCAATATGTCCCAGG + Intergenic
1087916937 11:103822033-103822055 CAGGAAGTTAAGCATCATTGTGG - Intergenic
1089670715 11:120055055-120055077 CAGGAACTTCAGTGTGATCCTGG + Intergenic
1089866414 11:121636686-121636708 CAGACAGTTCAGCACCATCCAGG - Intergenic
1090705427 11:129332067-129332089 CAGGAAAATCAGCAGGAACCGGG - Intergenic
1092427049 12:8383125-8383147 AAGGAAGTGCAGGATGCTCCTGG - Intergenic
1093144344 12:15546236-15546258 CAGGAAGTTCTGTATTATCAGGG + Intronic
1097323509 12:58250540-58250562 CAGGAAGTCCAGCTTTATGCAGG + Intergenic
1098044534 12:66386421-66386443 CAGGAAGATCAACACCATCCTGG + Intronic
1101397954 12:104364804-104364826 CAGGATGTTTAGCAGCATCCTGG - Intergenic
1102816760 12:115872210-115872232 CAGGATGATCAGCATGATTTGGG + Intergenic
1109267488 13:60217795-60217817 CAGGTAGTTAAGCATGAGCAGGG - Intergenic
1109637529 13:65142211-65142233 GAAGAAGTGCAGCGTGATCCAGG + Intergenic
1114938451 14:27574288-27574310 CAGGAATTTCAGAATGAAACTGG + Intergenic
1115137829 14:30132355-30132377 CAGGAAAATAAGCATGATTCTGG + Intronic
1118087837 14:62439879-62439901 AAGGAAGCTCAGCAAGATACAGG - Intergenic
1118549308 14:66932231-66932253 CAGGCAGTTCAGCATGAAGAGGG - Intronic
1118877414 14:69796999-69797021 CATGGAGTTCAGCAAGATCAAGG - Exonic
1119266722 14:73267114-73267136 CAGGATGTTTAGCAGCATCCAGG + Intronic
1119650686 14:76380900-76380922 CAGGATGTTCAGGAAGATTCCGG - Intronic
1120987130 14:90343934-90343956 TAGGATGTTCAGCAGCATCCCGG - Intergenic
1125254387 15:37745866-37745888 AAGGAAGCTCATCAAGATCCAGG + Intergenic
1125756713 15:42069946-42069968 CGGGAAGTGCAGCAGGATCGGGG + Exonic
1126211024 15:46100346-46100368 CACAAAGTTCATCATGATTCAGG - Intergenic
1126672935 15:51132863-51132885 GAGGAAGTACAGGATGGTCCCGG + Intergenic
1128390456 15:67179374-67179396 CAGGATGTTTAGCAGCATCCTGG - Intronic
1133371207 16:5247240-5247262 AAGGAAGTGCAGGATGCTCCTGG + Intergenic
1133564896 16:6984267-6984289 CAGGTAGTACAGGAGGATCCAGG - Intronic
1134865955 16:17607389-17607411 CAGGAAGTCCTGCCTGAGCCTGG + Intergenic
1135060357 16:19266363-19266385 TAGGAAGTTTAGCAGCATCCCGG - Intronic
1135391362 16:22096122-22096144 CAGGATGTTTAGCAGCATCCTGG - Intronic
1137465086 16:48700450-48700472 CAGGAAGGTCAGCATGGTATTGG - Intergenic
1138166152 16:54803452-54803474 CAGGAAGTCCCGGAGGATCCAGG + Intergenic
1138561967 16:57806452-57806474 CAGGAACGCCATCATGATCCAGG - Intronic
1138801543 16:60036516-60036538 CAGGAAGTTGAGAATGAGCAAGG + Intergenic
1139916741 16:70433000-70433022 CAGGAAGCTCACCAGGATTCCGG + Intronic
1140063929 16:71593995-71594017 TAGGAGGTTCAGGATGAGCCTGG + Intergenic
1142347491 16:89563193-89563215 CAGAAAGTAAAGCATTATCCAGG - Exonic
1144439166 17:15265935-15265957 CATGAAGGTCAGCTTGATTCGGG - Intergenic
1144950296 17:18990286-18990308 CAGGCAGGTCACCATGACCCTGG + Intronic
1146314377 17:31795663-31795685 CAGGAAGGTAAGCATGACCTGGG - Intergenic
1146970894 17:37071217-37071239 CCAGAAGTTCAGCATCAGCCTGG - Intergenic
1147305148 17:39558295-39558317 CTGGAAGTTCAGCTTCATCCAGG + Intronic
1147364046 17:39948672-39948694 CAGGAAGTTGTGCCTGACCCTGG + Intergenic
1147402842 17:40191468-40191490 CAAGAAGTTCATCAAGATCGCGG + Exonic
1148356070 17:46976868-46976890 CAGGAAGTCCAGCCTGATCTGGG - Intronic
1149419679 17:56497282-56497304 CAGGAAGTTCAGCAGTAGGCAGG - Intronic
1150601035 17:66651164-66651186 CAGGAAGCTCAGCACCATCCAGG + Intronic
1151520029 17:74621512-74621534 AAGGAAATCCAGCATGTTCCTGG + Intronic
1152220622 17:79063217-79063239 CAGGTAGTTCAGCTGGAGCCAGG + Intergenic
1153060546 18:990557-990579 CATGAAGTTAAGCATGATTTTGG - Intergenic
1154110616 18:11565576-11565598 GAGGAAGTTAAAAATGATCCAGG + Intergenic
1157239971 18:45999607-45999629 CAGGAAGTCCAGCATGGACAGGG + Intronic
1157938998 18:51905802-51905824 TAGGAAGCTTAGCATGATACTGG + Intergenic
1158204472 18:54976516-54976538 CAGGAGGCTCAACATGATCCTGG - Intergenic
1162218377 19:9155799-9155821 CAGCAAGATCTGCCTGATCCTGG - Intronic
1162361010 19:10220474-10220496 CACGAAGTTCATCAAGAACCAGG - Intronic
1165043564 19:33086076-33086098 CAGGATGTTCAGCAGCATCCTGG - Intronic
1167627671 19:50603500-50603522 CCGGAAGTTCAGGACCATCCTGG - Intergenic
926333959 2:11849479-11849501 CAGAGACATCAGCATGATCCCGG + Intergenic
926827318 2:16919311-16919333 CAGAAAGCACAGCATCATCCAGG - Intergenic
927466465 2:23340449-23340471 CAGGAAGGTAAGAATGTTCCAGG - Intergenic
927902593 2:26831547-26831569 CAGGAAGTTCAGCATGAGACAGG + Intergenic
927983647 2:27392174-27392196 CAGGAAGTTAAGCATGACTCTGG - Intronic
929782006 2:44962964-44962986 CAGGAAGTGCTGCATGGTCTGGG - Intergenic
930716145 2:54595810-54595832 CAGGATGTTAAGCAGCATCCTGG + Intronic
931996668 2:67845517-67845539 CAGGAATTTCAGCTTGTTACTGG - Intergenic
932672515 2:73750841-73750863 CAAGGAGGTCAGCATGACCCAGG - Intergenic
933367678 2:81374813-81374835 CAGGTAGTTAGGCATGAGCCAGG + Intergenic
936349602 2:111702788-111702810 CAGGCAGTAAAGCATGGTCCTGG + Intergenic
937310571 2:120900305-120900327 CTGGCAGTTTAGCAGGATCCTGG - Intronic
938139184 2:128782575-128782597 GGGCAAGTTCAGCATGTTCCAGG + Intergenic
938556176 2:132426231-132426253 CTGGAAGTTTAACAAGATCCAGG + Intronic
939652012 2:144775134-144775156 CTGAATGTTCAACATGATCCTGG + Intergenic
940409212 2:153340908-153340930 CAGCAACATCAGCATCATCCAGG + Intergenic
941033507 2:160540123-160540145 TAGGAAGTACAACATGAACCTGG + Intergenic
941599651 2:167526014-167526036 AAGGAAGTACAAGATGATCCAGG - Intergenic
941666945 2:168251518-168251540 CAGGAAGTTCAAGACCATCCTGG - Intergenic
946853400 2:223929482-223929504 CAGGAAGTTAAGCAGGAGGCTGG - Intronic
947778558 2:232735663-232735685 CAGGTAGTTCAGTATTATACTGG + Intronic
948748654 2:240114084-240114106 CAGGTAATTCAACATCATCCAGG + Intergenic
948843612 2:240672482-240672504 CAGGAAGTGGCGCAGGATCCGGG - Intergenic
948989952 2:241548632-241548654 CAGGCAGTTCAGCATCTCCCAGG - Intergenic
1170604478 20:17865398-17865420 GAGGATGTTCAGCAGCATCCTGG + Intergenic
1172887130 20:38238978-38239000 CAGGAACTTCGGGCTGATCCTGG - Intronic
1174172986 20:48628551-48628573 CAGGAAGCTGAGCAGCATCCCGG + Intronic
1174237360 20:49104886-49104908 CAGGAAGATCAGCCTGAGCCTGG + Intergenic
1175550568 20:59814538-59814560 CAGCAAGTCCAGCATGGACCGGG - Intronic
1178344383 21:31812247-31812269 CAGCAAGGTCAGCAAGAGCCAGG + Intergenic
1178357009 21:31917878-31917900 AAGCAAGTTTAGCATGTTCCAGG - Intronic
1178667393 21:34560760-34560782 CAGGAAGTACAGTAAGAGCCTGG + Intronic
1178746082 21:35251604-35251626 CAGGAACATCAGCCTAATCCTGG + Intronic
1180947251 22:19703184-19703206 ACTGGAGTTCAGCATGATCCTGG + Intergenic
1181105791 22:20574402-20574424 CAGGAACTCCAGCATGAGCCAGG - Intronic
1181679100 22:24479066-24479088 AAGGATGTTCAGGATGATTCTGG - Intergenic
1182912850 22:34001857-34001879 CAGGAAGCTCAGCATGCACAAGG - Intergenic
1183401904 22:37609567-37609589 AAGGAAGTTCAGCAAGAGCTGGG - Intronic
1183601685 22:38843847-38843869 CAGGAACTTCAGCGTGAGGCGGG + Exonic
1184103874 22:42356062-42356084 CAGCAAAGTCAGCCTGATCCAGG + Intergenic
1184208185 22:43018629-43018651 CAGGAACATCAGCAGGACCCAGG - Intergenic
950198325 3:11025474-11025496 CAGGATGATCAGCATGATGTAGG - Exonic
950885610 3:16359862-16359884 CAGGAACTCCAGCATGATTCAGG - Intronic
951060439 3:18200788-18200810 AAGGAAGCTCATCAAGATCCAGG - Intronic
953465694 3:43117439-43117461 TAGGAGGGGCAGCATGATCCTGG - Intergenic
955240959 3:57177746-57177768 CAGGAAATACAACATGACCCTGG - Intergenic
955376929 3:58405315-58405337 CAAAAAGTTCAACATGATCTGGG + Intronic
957071753 3:75572820-75572842 AAGGAAGTTCAGGTTGCTCCTGG - Intergenic
957504282 3:81099600-81099622 CCGGAAGTTCAGGATCATCCTGG + Intergenic
958485089 3:94695159-94695181 CAGGTAGTTCCTCCTGATCCTGG + Intergenic
960301816 3:116011782-116011804 CAGAAAGGTAAGAATGATCCTGG - Intronic
961241787 3:125417572-125417594 CAGAAAGTTCACCAAGATCCTGG - Intergenic
961537932 3:127581127-127581149 CAGGGAGTTCGGGGTGATCCAGG + Intronic
961815525 3:129548217-129548239 CAGGAAGTTAGGCAAGATGCAGG - Intronic
962101125 3:132343922-132343944 CTAGAAGTTCAGGATGAGCCTGG + Intronic
962143251 3:132812731-132812753 CCAGAAGTTCAACATCATCCTGG - Intergenic
962947763 3:140187382-140187404 AAGGGAGGTCAGCATGATCCAGG - Intronic
964609301 3:158594191-158594213 CAGGAAGTTCAGCATGCTATGGG + Intronic
966709984 3:182962210-182962232 CAGCAAGTTCAGGATGGGCCTGG + Intronic
966933069 3:184688264-184688286 CAGAAAGTTCAGTTTGAGCCAGG + Intergenic
968439111 4:612657-612679 CAGGAAGACCAGCAGGAGCCTGG + Intergenic
969015346 4:4100131-4100153 AAGGAAGTGCAGGATGCTCCTGG - Intergenic
972551021 4:40134491-40134513 CAGTAGGTTCAGCTTCATCCTGG + Intronic
972979967 4:44685285-44685307 CAGGATGTTCAGCAGCAACCAGG - Intronic
973692382 4:53450758-53450780 CAGGAAATTCACCATGATCATGG - Intronic
974860100 4:67510078-67510100 CAGCAAGATCAGCATTATCTGGG + Intronic
975899103 4:79129101-79129123 CAGGAAGATCATCAAGATTCAGG - Intergenic
977098607 4:92778057-92778079 TAGGATGTTCAGCAGCATCCTGG - Intronic
978604405 4:110463718-110463740 TAGGATGTTCAGCAGCATCCAGG + Intronic
980065914 4:128187999-128188021 TAGGCAGTACAGCATGATGCTGG - Intronic
980619524 4:135281260-135281282 CAGGGAGGTCAGCCTGCTCCAGG - Intergenic
980693808 4:136329805-136329827 AAGGAAGCTCATCTTGATCCAGG + Intergenic
982580562 4:157174115-157174137 CAGAAAATTAAACATGATCCTGG - Intergenic
986902729 5:12456884-12456906 CAGCAAGTTCAGCACAATGCTGG - Intergenic
986954543 5:13135471-13135493 CAGGTAGTTCAGCATGAACAGGG + Intergenic
987847378 5:23304025-23304047 CAGGAAGTCCAGCACGACCCCGG + Intergenic
989115236 5:37945960-37945982 CAGCAAGTTCATCAATATCCAGG - Intergenic
989601565 5:43205104-43205126 CATGAAGTCCAGCATCAGCCTGG - Intronic
989782451 5:45284678-45284700 CTGGTATTTCAGCATGAACCAGG + Intronic
993849635 5:92990783-92990805 CGGCAAGTTCAGCGTTATCCAGG + Intergenic
997353103 5:133244796-133244818 CAGGAAGTTCAGCCTGGGCCTGG - Intronic
1003535757 6:6973962-6973984 CAGGATGTTTAGCAACATCCCGG - Intergenic
1004142384 6:13030944-13030966 CAGGATGTTCAGCAGTATCCTGG + Intronic
1005477192 6:26219175-26219197 GATGAATTTCAGCATGATTCAGG - Intergenic
1007727113 6:43923307-43923329 AAGGAAGTGCAGTATGCTCCTGG - Intergenic
1008042527 6:46816881-46816903 CAGGAAGGTGAGCAGGAGCCTGG + Intronic
1008925013 6:56882958-56882980 CAGGAGGATCAGCTTGAACCTGG - Intronic
1010682448 6:78812430-78812452 CAGTACGTTTAACATGATCCTGG - Intergenic
1015282754 6:131451488-131451510 CAGGGAATTCAGCATCATGCTGG + Intergenic
1015305392 6:131701147-131701169 CAGGAGGTTCACCAGCATCCGGG + Exonic
1015655878 6:135518610-135518632 CAGGGACTTCTGCATCATCCAGG - Intergenic
1015863622 6:137705885-137705907 CAGGAAGTCCAGCATGCCCCCGG + Intergenic
1016334315 6:142988149-142988171 CAGGAAGATCAGAATGTTCTAGG + Intergenic
1017621900 6:156307539-156307561 CAGGAGCTTTAGCATCATCCAGG + Intergenic
1019074960 6:169379643-169379665 CAGGAAATCCAGCAGCATCCCGG + Intergenic
1019221830 6:170479149-170479171 CAGGCAGGTCAGGATGCTCCTGG - Intergenic
1019523341 7:1470171-1470193 CAGGGAGTTGAGCAGGGTCCGGG - Intergenic
1020794989 7:12668147-12668169 CAGTAAGTACAGCAGGATCTGGG + Intergenic
1020916805 7:14204667-14204689 AAGGAAGTTTAGCATGTTTCTGG + Intronic
1022246520 7:28565303-28565325 CAGGAAGCTCAGTATGTTACAGG + Intronic
1023271693 7:38470029-38470051 CAGGATGTTCAACCTGATCAAGG - Intronic
1028618019 7:92791760-92791782 AAGGAAGTTTGGCATGGTCCTGG + Intronic
1029074011 7:97921791-97921813 AAGGAAGTGCAGGATGCTCCTGG - Intergenic
1032082900 7:128869060-128869082 CAGGAAGTTCTGGGTGTTCCTGG + Intronic
1033739502 7:144259374-144259396 CAGGAGGTTCACCAGCATCCGGG + Exonic
1036243692 8:7099504-7099526 AAGGAAGTGCAGGATGCTCCTGG + Intergenic
1036257109 8:7214553-7214575 AAGGAAGTGCAGGATGCTCCTGG - Intergenic
1036309159 8:7673152-7673174 AAGGAAGTGCAGGATGCTCCTGG - Intergenic
1036360376 8:8072967-8072989 AAGGAAGTGCAGGATGCTCCTGG + Intergenic
1036890593 8:12594000-12594022 AAGGAAGTGCAGGATGCTCCTGG - Intergenic
1036898147 8:12651920-12651942 AAGGAAGTGCAGGATGCTCCTGG - Intergenic
1037831443 8:22192044-22192066 CGTGAAGTTCAGGATGATCTAGG - Exonic
1039114572 8:34078321-34078343 TAGCAATTTCAGCATGATTCAGG + Intergenic
1041252608 8:55948728-55948750 CAGGGACTTAAGCCTGATCCTGG + Intronic
1041311272 8:56519360-56519382 CTGGAAGTTCCTCATGATACCGG + Intergenic
1042221903 8:66482801-66482823 CTAGAAGTTCAGCATGAGCTAGG + Intronic
1042358832 8:67859589-67859611 CAGTAAGTTCACCATGCTGCAGG + Intergenic
1049079007 8:140426614-140426636 CAGGAAGTTCTCATTGATCCAGG - Exonic
1051137270 9:13936420-13936442 CAGAAAGCACAGCATGACCCAGG + Intergenic
1052363996 9:27590495-27590517 AAGGAAGTACATCAAGATCCAGG + Intergenic
1055056340 9:72027746-72027768 CAGAAAGCACAGCTTGATCCAGG - Intergenic
1056843366 9:90016799-90016821 CATTAAGTTTAGCATTATCCAGG - Intergenic
1057035954 9:91811703-91811725 CAGGCATGTCAGCATGTTCCAGG - Intronic
1058135878 9:101307038-101307060 CAGGAAGTACCGCATCAGCCTGG - Intronic
1059778971 9:117507088-117507110 AAGGAAGTTCATCAAGATTCAGG - Intergenic
1060321736 9:122568217-122568239 CAGGAAGTTCATCAGCATCTTGG + Exonic
1186452693 X:9686603-9686625 CAGGAAGATCAGTTTGGTCCAGG + Intronic
1186958785 X:14712250-14712272 CAGGATGTTCAGCAGTATCCTGG + Intronic
1189488955 X:41454814-41454836 CCGGAAGTTCAGGATGAGCCTGG - Intronic
1191112539 X:56817420-56817442 TGGTAAGTTCACCATGATCCAGG - Intergenic
1191710731 X:64147945-64147967 CAGGAATATCAGCATTATCTGGG + Intergenic
1195017290 X:100792004-100792026 CAGGAAGTTCAGATTGGTCAGGG - Intergenic
1197926324 X:131650265-131650287 AAGGAAATTCAGCCTGAGCCTGG - Intergenic
1199497040 X:148464148-148464170 CAGCAAGATCAGCATGAGCTAGG + Intergenic