ID: 1074324194

View in Genome Browser
Species Human (GRCh38)
Location 10:112431867-112431889
Sequence CACTGAAAACAGATGGAGCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 346
Summary {0: 1, 1: 0, 2: 3, 3: 22, 4: 320}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074324194 Original CRISPR CACTGAAAACAGATGGAGCT AGG (reversed) Intronic
903013637 1:20348047-20348069 AACTGGAAAGAGATGGGGCTGGG + Intronic
904175969 1:28629151-28629173 AACTGATAACAGAGGGAGGTGGG + Intronic
904985959 1:34549197-34549219 CACTGAGAACAAATGGAGGGAGG + Intergenic
905024159 1:34838361-34838383 CACTGGACACAGATGGAGTAAGG + Intronic
905791445 1:40791778-40791800 CACTGGAAATAAATGGAGCATGG + Intronic
906322147 1:44823448-44823470 CTCTGAAGACAGATACAGCTCGG - Intronic
907304771 1:53507387-53507409 CTCTGAAGCCAGATGGACCTGGG - Intronic
909046606 1:70718186-70718208 CTCTGAAATCAGATGGAACTGGG - Intergenic
909539892 1:76779606-76779628 CACTGGAAAAAAATGGAGTTTGG + Intergenic
909549062 1:76878042-76878064 GACAGAAGACAGATGGATCTTGG - Intronic
910396168 1:86795986-86796008 CACTCAAAACTGGGGGAGCTGGG + Intergenic
910967045 1:92818337-92818359 TACTGGAAACAGATGAATCTTGG + Intergenic
912550778 1:110483893-110483915 CACTGAAGACAGACGGCACTGGG - Intergenic
915245626 1:154554533-154554555 CACTGAAGACAGGTGCAGCGCGG - Intronic
915363082 1:155297576-155297598 CACTGAAAATAGATGGGGGGTGG - Intronic
915981557 1:160423626-160423648 AACTGACATCTGATGGAGCTGGG - Intronic
916291489 1:163171422-163171444 AACTGAAAACAGTTGCAGCATGG - Intronic
918162395 1:181913719-181913741 CACTGTTAAAAGATGGTGCTGGG + Intergenic
918206672 1:182315632-182315654 AACTCAAAACAGATGGAACAGGG + Intergenic
919888099 1:201949738-201949760 CACTGAAACCAGATGGTACAGGG - Intergenic
920248608 1:204606968-204606990 CATTGAAAAGATAAGGAGCTAGG - Intergenic
921030428 1:211331204-211331226 AATTGAATACAGATGGACCTGGG - Intronic
921555463 1:216593447-216593469 CACTTAAAACAGATGGGGTTGGG - Intronic
922043778 1:221923236-221923258 CATGGAAAACATATGGAACTAGG + Intergenic
922995464 1:229954872-229954894 CAGTGAAAACATATGGTGTTTGG + Intergenic
923378428 1:233390171-233390193 TTCTGACACCAGATGGAGCTTGG - Intergenic
923643016 1:235784789-235784811 TAGTTAAATCAGATGGAGCTGGG - Intronic
924386822 1:243506913-243506935 CAGTAAAAACGGAAGGAGCTGGG + Intronic
1062988770 10:1795560-1795582 GACAGAAAATAGATGAAGCTTGG + Intergenic
1067928062 10:50530965-50530987 GACTGAAAACATATTGAGCAGGG + Intronic
1068684552 10:59856248-59856270 AACTGGAAAAAGAGGGAGCTGGG - Intronic
1068693789 10:59944326-59944348 CACTGTCAAGGGATGGAGCTTGG + Intergenic
1069367969 10:67713732-67713754 CAATGAAAATAGATGGACATAGG + Intergenic
1069630328 10:69893678-69893700 CAGTGGAAACAGCTGGACCTTGG + Intronic
1071468928 10:85965583-85965605 CACTGAGAACACATGGACATAGG + Intronic
1073660475 10:105470570-105470592 TACTGAAAACAACTGGAGTTAGG + Intergenic
1073711809 10:106051781-106051803 CAATGAAAACACATGGACATAGG - Intergenic
1074139725 10:110661336-110661358 CACTGGCAACTGCTGGAGCTGGG - Intronic
1074235806 10:111583372-111583394 TACAGAAGACAGATGGATCTTGG - Intergenic
1074280962 10:112051098-112051120 CAATGAAAAAAGAGGAAGCTGGG + Intergenic
1074324194 10:112431867-112431889 CACTGAAAACAGATGGAGCTAGG - Intronic
1074381562 10:112984939-112984961 CACTGAAGTCAGACGTAGCTGGG + Intronic
1074747331 10:116547758-116547780 TACAGAAAACAGGTGGAACTTGG - Intronic
1075544413 10:123343547-123343569 CTCTGGAAACAGATGGAGCTGGG + Intergenic
1075684584 10:124354599-124354621 CACTGAGGACAGGTGAAGCTGGG + Intergenic
1078589662 11:12628465-12628487 CATTGAGACCAGATGTAGCTGGG - Intergenic
1078918866 11:15808140-15808162 TAATGAAAACAAATGGAGCTGGG - Intergenic
1079318787 11:19432589-19432611 CACTGAGAAGACATGGAGCATGG + Intronic
1080020242 11:27552558-27552580 TGCAGAAGACAGATGGAGCTTGG - Intergenic
1080083443 11:28249918-28249940 CACTGAATACACATGGACATAGG - Intronic
1080301689 11:30791629-30791651 CAGGGAAAAGAGATGGGGCTGGG + Intergenic
1080301986 11:30794805-30794827 CAAGGAAAAGAGATGGGGCTGGG - Intergenic
1081108518 11:39102323-39102345 CAATAAAAACAGATGGACCTAGG - Intergenic
1082142049 11:48620402-48620424 CAATGAGAACACATGGACCTGGG + Intergenic
1082569211 11:54717221-54717243 CAATGAGAACACATGGACCTGGG + Intergenic
1082912818 11:58395971-58395993 CACTGAAAGGAGATGGGGGTGGG + Intergenic
1083337007 11:61928395-61928417 CCCTCAAAATATATGGAGCTAGG + Intergenic
1083337047 11:61928659-61928681 CCCTCAAAATACATGGAGCTAGG + Intergenic
1084088013 11:66863594-66863616 CTCTGAAAACAGCTGGAGTCTGG + Intronic
1085311832 11:75521368-75521390 CAATTCAAACAGATGCAGCTTGG + Intronic
1086293234 11:85335741-85335763 CAATGAGAACACATGGAGATGGG + Intronic
1086763513 11:90664709-90664731 CAATGAAAACACATGGACATAGG - Intergenic
1087103933 11:94392270-94392292 CAATGAGAACACATGGACCTAGG + Intronic
1089315163 11:117586527-117586549 AACTGAGAACAGAGAGAGCTGGG - Intronic
1089610092 11:119664241-119664263 CAGTGAAATCTGATGCAGCTGGG - Exonic
1089903503 11:122012708-122012730 TACAGAATACAGATGGATCTTGG + Intergenic
1090209610 11:124908935-124908957 TACAGAAGACAGATGGATCTTGG - Intergenic
1091578955 12:1768809-1768831 TACTGAAAACAGATGGCGGGAGG + Intronic
1094285612 12:28789734-28789756 CACTGAACTAAGATGGAACTGGG + Intergenic
1094530021 12:31265666-31265688 CTCTGAAAGCAGATGGAGCTAGG + Intergenic
1094672703 12:32586599-32586621 AAGGGAAAACAGATGGAGCAGGG + Intronic
1094813058 12:34160867-34160889 CTCTGAAATCAGATGGAGGAAGG + Intergenic
1096076842 12:48811220-48811242 GGCTGAAAAGAGATGGAGGTGGG - Intergenic
1096604104 12:52752741-52752763 CTCAGGACACAGATGGAGCTGGG - Intergenic
1097604378 12:61734311-61734333 CATTGAAAACACATGGACATGGG + Intronic
1097759378 12:63444092-63444114 CACTGAGAACACATGGACCCAGG - Intergenic
1097957536 12:65501505-65501527 CACTGAGAAAAGCTAGAGCTGGG + Intergenic
1098837505 12:75440503-75440525 TGCTGAAAATAGATGGATCTTGG - Intergenic
1100083207 12:90877330-90877352 TACAGAAGACAGATGGATCTTGG + Intergenic
1100162710 12:91879219-91879241 CTTTGAAATCAGATGGAACTGGG + Intergenic
1100931707 12:99617585-99617607 CAATGAGAACACATGGACCTGGG + Intronic
1102304035 12:111791459-111791481 CACTGAGGACAGGGGGAGCTTGG - Intronic
1102674822 12:114650222-114650244 CACAGAAAGGAAATGGAGCTTGG + Intergenic
1103323687 12:120106179-120106201 CACTGAACACAGATTGGGATGGG + Intronic
1103821883 12:123705459-123705481 CACTTAAAACCGATGGAGGCAGG - Intronic
1104322069 12:127761285-127761307 CCCTGAAGTCAGATGGCGCTGGG - Intergenic
1106137759 13:26986909-26986931 CATTGAAAATATATGGTGCTGGG - Intergenic
1106936194 13:34723377-34723399 CACTGAAAAAAGATCTTGCTTGG + Intergenic
1108672199 13:52702895-52702917 TACTGAAAACAGATTGAGAAAGG + Intergenic
1108914404 13:55589787-55589809 TGCTGAAGACAGATGGATCTTGG - Intergenic
1109038864 13:57304214-57304236 CACTGAAAACTGACTGTGCTGGG - Intergenic
1110221444 13:73078693-73078715 CAATGAGAACACATGGAGATAGG - Intergenic
1110361925 13:74636136-74636158 TAATGAAAAGAAATGGAGCTGGG + Intergenic
1110377072 13:74805579-74805601 TGCAGAAAACAGATGGATCTTGG + Intergenic
1111224129 13:85247072-85247094 CATTTAAAACAAATGGATCTTGG - Intergenic
1111470957 13:88681959-88681981 TTCTTAAAACAGATGGATCTTGG - Intergenic
1111796593 13:92928571-92928593 CAATGAAAACACATGGACATAGG + Intergenic
1113504225 13:110802439-110802461 CACTGAAGACAGAAGGAAATAGG + Intergenic
1114055509 14:18964631-18964653 CACTGGGACCAGATGGAGCCAGG + Intergenic
1114107036 14:19437132-19437154 CACTGGGACCAGATGGAGCCAGG - Intergenic
1116645760 14:47526918-47526940 AACTCAAAGCAGATGGGGCTTGG - Intronic
1117596383 14:57330780-57330802 TACAGAAGACAGATGGATCTTGG - Intergenic
1117630951 14:57690884-57690906 CTCTAAATACAGATGAAGCTTGG + Intronic
1119020719 14:71110049-71110071 GACTGAAAATAGAATGAGCTTGG + Exonic
1119308991 14:73631051-73631073 CACTGAAAACACATGGCCATTGG - Intergenic
1121113106 14:91325863-91325885 CATTGAAAACAGATTGGGCTCGG - Intronic
1121211126 14:92208505-92208527 CACTGAAGACAGTAGGAACTAGG - Intergenic
1121393786 14:93599904-93599926 CATTAAAACCAGATGCAGCTGGG + Intronic
1121452063 14:94014986-94015008 CACTGAATTCAGAGGGAGGTTGG + Intergenic
1121771205 14:96542353-96542375 CACTGAACACAGTAGGAGATGGG + Intronic
1123187222 14:106531320-106531342 CACTGAAAACAGCATAAGCTTGG - Intergenic
1124787720 15:32697710-32697732 CACTGATAACTGTTGAAGCTGGG + Intergenic
1124823074 15:33067050-33067072 CACTGAAAAAAGCTGGAAGTTGG + Intronic
1125442063 15:39713821-39713843 CAGTGAAAACAGCTGGAGCCAGG + Intronic
1129690105 15:77708357-77708379 CAGAGGAAACTGATGGAGCTGGG + Intronic
1130072202 15:80657096-80657118 CACTGAAAACAGATGTTGTATGG - Intergenic
1130932658 15:88440798-88440820 CAATGAGAACAGATGGACATAGG - Intergenic
1132305888 15:100812064-100812086 CACAGAAGACAGATGGATCTTGG - Intergenic
1134821749 16:17252573-17252595 CACCGAAAAGGGATGGAGCTGGG + Intronic
1134826542 16:17289008-17289030 AGCTGATAAGAGATGGAGCTGGG + Intronic
1135474496 16:22762372-22762394 CCCAGAAAACAGATGGAGTTTGG + Intergenic
1135497486 16:22965302-22965324 CACTCAAAGCAAATGGGGCTTGG - Intergenic
1137569112 16:49553126-49553148 CTCTGAAGGCAGAAGGAGCTGGG + Intronic
1138188549 16:54995867-54995889 CAGTGAAAACAGGCTGAGCTGGG - Intergenic
1139510437 16:67425194-67425216 AACTGAAACCAGATGGAGGGGGG - Intergenic
1140219203 16:73031678-73031700 CACAGCAAACAGAACGAGCTGGG + Intronic
1141274430 16:82573730-82573752 CACTGATCACAGATGCCGCTGGG + Intergenic
1143045734 17:4077841-4077863 CCATGAAAACAGATGGCGTTTGG - Intronic
1143201578 17:5116878-5116900 TACTGAAAAGTGATGGAGCTAGG + Intronic
1143466600 17:7141047-7141069 CACTGCAACCAGATGTAGTTGGG - Intergenic
1144169078 17:12641322-12641344 AACTGAAAATAGATGGTGGTGGG - Intergenic
1144768683 17:17746928-17746950 CTCAGAAAACACATGGGGCTGGG - Intronic
1146546363 17:33742215-33742237 CACTGGAAACAAATGGGGCGTGG - Intronic
1146982880 17:37182655-37182677 CAGTGAATACAAATGGAGATTGG + Intronic
1148062733 17:44847882-44847904 CAGTGAAGACAGAATGAGCTGGG + Exonic
1148505463 17:48123625-48123647 GACTGAAAAGAGATGGTGCCTGG - Intergenic
1148614974 17:48995438-48995460 CGCTGAAAAGAAATGGGGCTGGG - Intergenic
1150121653 17:62608465-62608487 CCCTGAATACAGATGAAGCTGGG - Intronic
1150959832 17:69901167-69901189 GACTCAAAAGAGATGGAGCAAGG - Intergenic
1152306269 17:79522476-79522498 CCCTGAAAATAGTTGGAGTTGGG - Intergenic
1153029230 18:698087-698109 CACAGAAAACATATGGGGCTGGG - Intronic
1153267368 18:3284627-3284649 CACTGATAACAGATTGAGGGTGG + Intergenic
1153317243 18:3736373-3736395 CCCTAAAAACAGATTGTGCTTGG - Intronic
1153700959 18:7692690-7692712 CAGTGAAAACAGAGGAAGATAGG - Intronic
1153896902 18:9571587-9571609 CACTGAACACAGGAGGAGATGGG + Intronic
1156029201 18:32692735-32692757 CTCTGAAATCAGATAGACCTAGG + Intronic
1157267830 18:46244221-46244243 CACTGCAAACAAATGTAGTTGGG + Intronic
1157810017 18:50688251-50688273 AACTGAAGAAAGATGGAGTTTGG + Intronic
1158730551 18:60017897-60017919 CAATGAAAACACATGGACATAGG - Intergenic
1158923434 18:62222559-62222581 CAGTGAATACTGATAGAGCTAGG - Intronic
1158953052 18:62514464-62514486 CAGTGAAAACAACTGGACCTGGG - Intergenic
1159453336 18:68630196-68630218 CACTGAATACATATGCAGGTGGG - Intergenic
1159652857 18:70998360-70998382 CACTGAATGCAAATGGAGATGGG - Intergenic
1159829781 18:73261808-73261830 CACTGAAAACACAGAAAGCTAGG + Intronic
1161261486 19:3340256-3340278 CCCAGAAAACAGAAGCAGCTTGG + Intergenic
1164225829 19:23245179-23245201 CACTGAAGACAAATTCAGCTGGG - Intronic
1166169494 19:41017684-41017706 TAATGAAAACATTTGGAGCTAGG - Exonic
1166317649 19:41998018-41998040 GACAGAAAACAGATGGGGCTGGG - Intergenic
1167646536 19:50708802-50708824 CACTCAACAAAGATGGAACTAGG + Intronic
925050510 2:811134-811156 CATTGAAAACAAATGAGGCTTGG - Intergenic
925916025 2:8606991-8607013 CACTGAGAACAGATGAAACCAGG + Intergenic
927583493 2:24277322-24277344 CTCTGAAAAGAAATGGAGTTTGG - Intronic
928225780 2:29446992-29447014 CACTTAAAACTGATGGTGCCAGG + Intronic
930330304 2:49975009-49975031 CACTGGAAACAGATGTATTTGGG - Intronic
930381271 2:50633182-50633204 CAATGAAAACAAATGGGCCTGGG + Intronic
931650354 2:64462867-64462889 CAGGGAAAATCGATGGAGCTAGG + Intergenic
932427030 2:71644421-71644443 CATTGAAAACAGTTAAAGCTTGG + Intronic
933346177 2:81088479-81088501 GACTGTAGAGAGATGGAGCTGGG + Intergenic
933985529 2:87589024-87589046 CACTGAGAACACATGGAACCAGG + Intergenic
934790773 2:97058290-97058312 AGCTGAAAAGAGAGGGAGCTGGG + Intergenic
934927904 2:98394549-98394571 TGCTGATAACAGCTGGAGCTGGG - Intronic
935607799 2:104987980-104988002 CAATGAGAACAGATGGACATAGG + Intergenic
936087967 2:109482400-109482422 CTTTGGCAACAGATGGAGCTGGG - Intronic
936915894 2:117638763-117638785 TACTGAAACCAGATGAATCTTGG - Intergenic
936945872 2:117930277-117930299 CACTGAAACCACATGGATTTAGG + Intronic
937405026 2:121619855-121619877 CACTGAGAACTGCTGAAGCTTGG + Intronic
937459029 2:122069676-122069698 GAATGAAGAAAGATGGAGCTGGG - Intergenic
937506871 2:122547454-122547476 CATTTAAAACAGTTGGAGTTAGG - Intergenic
937852672 2:126649623-126649645 TGCAGAAGACAGATGGAGCTTGG - Intergenic
939755149 2:146100903-146100925 CACAGAAAACAGATAGATCTTGG + Intergenic
940171428 2:150833620-150833642 TGCAGAAAACAGATGGATCTTGG - Intergenic
940305769 2:152224747-152224769 AACTGAAAACAGATAGAGGTGGG - Intergenic
941088985 2:161152338-161152360 AAATGAAAGCAGAAGGAGCTTGG - Intronic
941743224 2:169058747-169058769 CAATGAAAACAGATGGACCCAGG + Intergenic
942383889 2:175421328-175421350 TACAAAAAATAGATGGAGCTGGG + Intergenic
943266081 2:185734782-185734804 CACTCAAAAGAGATAGTGCTGGG + Intergenic
945399866 2:209368119-209368141 GACTGGTAACAGCTGGAGCTGGG - Intergenic
945987987 2:216370509-216370531 CACTGAACAAAGTTGGAGGTTGG - Exonic
946478459 2:220031304-220031326 CCCTGAAACCAGATGGATCATGG + Intergenic
947862899 2:233374992-233375014 ACTTGAAAACAGATGGAGCCGGG + Intronic
948672252 2:239576032-239576054 GGCTGGAAACAGAGGGAGCTTGG + Intergenic
1168990568 20:2092248-2092270 CACTAAAAAGCGATGGAACTTGG - Intergenic
1170253319 20:14311187-14311209 CACTTACCACAAATGGAGCTTGG - Intronic
1170838929 20:19908105-19908127 CCCTGCAGACAGATGGAGCATGG - Intronic
1170999725 20:21400587-21400609 CATTGAAAACAGACGAAGATAGG + Intergenic
1174135234 20:48374677-48374699 GACTGAAAACACCTGGAGGTTGG - Intergenic
1175390550 20:58624600-58624622 CTCTGAAAACACATGAAGCACGG - Intergenic
1175526030 20:59634251-59634273 CTCTGAAATCAGGCGGAGCTGGG + Intronic
1175905047 20:62375516-62375538 CGCTGACCACAGATGGTGCTGGG + Intergenic
1177257894 21:18689886-18689908 TGCAGAAAACAGATGGATCTTGG + Intergenic
1177386620 21:20417855-20417877 CATTCAAAACAAATGGGGCTGGG + Intergenic
1178060864 21:28852041-28852063 TACAGAAGACAGATGGATCTTGG - Intergenic
1178105749 21:29317483-29317505 CCCTGAAATCAGTAGGAGCTTGG + Intronic
1178305494 21:31487192-31487214 GTCTGAAAACAGCTGGAGGTGGG + Intronic
1180050776 21:45330123-45330145 CACTGAAAACAGCACGGGCTGGG - Intergenic
1180473987 22:15687183-15687205 CACTGGGACCAGATGGAGCCAGG + Intergenic
1182335045 22:29578470-29578492 CTTTGAAATCAGATGGACCTGGG - Intronic
1183547652 22:38463456-38463478 CACTCAAAATATATTGAGCTGGG + Intergenic
1184428410 22:44426716-44426738 CACTGAAAACAGGCGGGGCGTGG + Intergenic
1184702451 22:46185185-46185207 GAGTGAAAACAGATGGAACATGG - Intronic
1185029588 22:48434650-48434672 CACTGAAACCAGCTGTGGCTGGG - Intergenic
950704789 3:14773037-14773059 CACAGAAGACAGAATGAGCTGGG - Intergenic
951230938 3:20179092-20179114 GACTGAAAAGGGATGGAGATGGG + Intronic
952412892 3:33065210-33065232 CACTGAAAAAAGAAGGTGGTTGG + Intronic
952511489 3:34061286-34061308 CACTGAAAACACATGGACACAGG + Intergenic
952943450 3:38460117-38460139 CCCCAAAAACAGATGGAACTAGG - Intronic
953046581 3:39298403-39298425 CACTGCAGGCATATGGAGCTGGG - Intergenic
953569030 3:44057133-44057155 CACAGGAAACAGAAGGACCTCGG - Intergenic
953717944 3:45332025-45332047 CACTGAAAATACATGGAAATAGG - Intergenic
959684970 3:109135140-109135162 CAATGAAAACACATGGACATAGG + Intergenic
962287915 3:134103845-134103867 CACTTTGAAAAGATGGAGCTGGG - Intronic
963401235 3:144802292-144802314 CACTGCAAGCAGATGTAGCCAGG + Intergenic
963566796 3:146940076-146940098 TGCAGAAAACAGATGGATCTTGG + Intergenic
964705167 3:159610547-159610569 TAATGAAAACAGAGGGAGGTAGG - Intronic
964853813 3:161123632-161123654 CAATGAAAACATATGGACATAGG + Intronic
967898823 3:194425842-194425864 CACTGAAAAGTGATAGTGCTTGG - Intronic
970531586 4:16990674-16990696 TACTGAGAACAGAAGGAACTGGG + Intergenic
970825477 4:20268017-20268039 CACTGAAAACAGATGGGATTGGG + Intronic
971873981 4:32280696-32280718 CAATGAGAACACATGGAGATAGG + Intergenic
972307032 4:37840682-37840704 CTCTAAAATCAGATGCAGCTGGG - Intronic
973544325 4:51965706-51965728 CACTCAATGCAGATGTAGCTGGG - Intergenic
973995036 4:56450118-56450140 CACTGAAAACACATGGACACAGG + Intronic
974893121 4:67906519-67906541 CCCTTAAAGCAGATAGAGCTTGG - Intergenic
975632636 4:76418243-76418265 CATTAAAAGCAGATGGTGCTGGG + Intronic
976034299 4:80796662-80796684 TACAGAAGACAGATGGATCTTGG - Intronic
976847947 4:89511631-89511653 CAATGAAATGAGATGGAGTTGGG + Intergenic
978013864 4:103720129-103720151 CGCTGCAAGCAGCTGGAGCTTGG + Intergenic
978385979 4:108175681-108175703 CATTGAAAATAGAAGGTGCTTGG - Intergenic
978957989 4:114638520-114638542 CAAGGAAAACAGATGGAGGGAGG - Intronic
980629423 4:135413372-135413394 TGCAGAAAACAGATGGATCTTGG + Intergenic
983166765 4:164487331-164487353 CAATGAGAACAGATGGACATAGG + Intergenic
984061190 4:174990703-174990725 TACAGAAGACAGATGGATCTTGG - Intergenic
984854576 4:184183772-184183794 CACTGTGAACAGATGTTGCTGGG + Intronic
984874736 4:184357058-184357080 CACTGGAAACAGGATGAGCTGGG - Intergenic
985877190 5:2609144-2609166 CAGTGAAAACAAAATGAGCTAGG + Intergenic
987244019 5:16029937-16029959 AATAGAAAACAGATGGAGTTTGG - Intergenic
987787962 5:22526641-22526663 TGCTGAAGACAGATGGATCTTGG - Intronic
988186846 5:27875118-27875140 CACTTACAATAAATGGAGCTTGG - Intergenic
988665874 5:33326745-33326767 CAGTGAGAACACATGGATCTAGG - Intergenic
989018768 5:36973874-36973896 CAATGAAAACACATGGACCCAGG - Intronic
989206097 5:38810019-38810041 TACTTAAGAAAGATGGAGCTGGG + Intergenic
989781111 5:45265715-45265737 AACTCAAAAAAGATGGGGCTGGG - Intronic
990604406 5:57394495-57394517 TACTGAGAACAGAAGGAACTTGG - Intergenic
992163165 5:74022016-74022038 CAATGAGAACACATGGATCTGGG - Intergenic
992648639 5:78835766-78835788 CACTGAAGCCAGAGGGACCTTGG + Intronic
993795932 5:92267967-92267989 CACTGCAAACAGAGGCAGCGAGG - Intergenic
994159475 5:96540276-96540298 GAATGATAACAGATGGAGATAGG - Intronic
995291216 5:110456781-110456803 CTCTTAAAACAAATGGTGCTGGG + Intronic
996907425 5:128616919-128616941 ACCTGAAAAGAGATGGAACTGGG - Intronic
997435700 5:133873348-133873370 CACTGAAAACAGGTGAAACCCGG + Intergenic
997436724 5:133880984-133881006 CACTTAAAGCAGAAGGAGATGGG - Intergenic
998855152 5:146387543-146387565 AAGAGAAAACAGATGGAGATGGG - Intergenic
999019972 5:148154376-148154398 CACTGCAAACAGATACAGCAAGG - Intergenic
999755403 5:154660534-154660556 GACTGAAAACAGAGGCAGATAGG + Intergenic
1000182518 5:158825424-158825446 CACTGAAAACAGATATGGTTTGG - Intronic
1005773756 6:29105958-29105980 CAATGAGAACAGTTGGACCTGGG - Intergenic
1007783996 6:44270216-44270238 CACGGAGAACAGATGGAGAGGGG + Intergenic
1008033133 6:46719381-46719403 CACTGGCACCAGCTGGAGCTTGG + Intronic
1008663814 6:53696723-53696745 CACTGAAGACAGCGGGAGGTGGG - Intergenic
1011008309 6:82673975-82673997 CAGTGAGAACACATGGTGCTTGG - Intergenic
1011199335 6:84817786-84817808 CAATGAGAACACATGGAGATAGG - Intergenic
1011407299 6:87029487-87029509 CACTGAAAACAGGAGGATTTAGG - Intergenic
1013357249 6:109356904-109356926 AACAGAACACAGATGGAACTTGG + Intergenic
1014107884 6:117587802-117587824 CAATGACTACTGATGGAGCTTGG - Intronic
1014185832 6:118433114-118433136 CAATGAGAACAGATGGAAATAGG + Intergenic
1015924066 6:138292104-138292126 GACTGAAACCAGATGGATGTGGG - Intronic
1016607151 6:145943192-145943214 CACTGGTGACAGATGGAACTTGG + Exonic
1016644095 6:146384062-146384084 GAGAGAAAACAAATGGAGCTTGG + Intronic
1016841397 6:148529110-148529132 CTGTGAAAACAGATGAAGCTTGG + Intronic
1017378205 6:153796235-153796257 CCTTGAAATCAGATGGACCTGGG + Intergenic
1021690045 7:23222700-23222722 CAGAGAAAACGGATGCAGCTAGG + Intergenic
1023682029 7:42696968-42696990 CTCTGAAACCAGAGGGAGCATGG + Intergenic
1024759416 7:52576598-52576620 CACAGAAAACAGATCGAGAAAGG - Intergenic
1026428163 7:70317106-70317128 CACTGGAAACAGTTGCTGCTGGG + Intronic
1027352519 7:77326563-77326585 CACTGGAAACAGAGGGACTTGGG + Intronic
1027484977 7:78750075-78750097 CAGTGAAAACACATGGAGATGGG - Intronic
1028658709 7:93241299-93241321 CACTGGTCACTGATGGAGCTAGG - Intronic
1029660699 7:101959219-101959241 CACTGCACACACATAGAGCTAGG - Intronic
1030906285 7:115187407-115187429 CAATGAAAACAGATGGACACAGG - Intergenic
1031781503 7:125973213-125973235 CACAGAAAATAGTTGGAGCCAGG - Intergenic
1033549274 7:142431814-142431836 CAGTAAGAACAGATGGAACTGGG + Intergenic
1036469764 8:9042179-9042201 CACAGAAAAGAGAAGGAACTTGG + Intronic
1038183437 8:25249900-25249922 CAATGAAAAGAGATGAAGTTGGG - Intronic
1041128195 8:54666838-54666860 CTCTGAGAACAGATGGGGCTTGG - Intergenic
1041769620 8:61458692-61458714 AACTGAAAACAAATGGGGCTTGG + Intronic
1042078083 8:65018008-65018030 CAGGGAAAACAGAGGTAGCTAGG + Intergenic
1042448459 8:68917164-68917186 CACTGAACACAGCTAGAGTTGGG + Intergenic
1042461437 8:69073568-69073590 CTCTCAAATCAGATGGACCTGGG - Intergenic
1042644450 8:70970512-70970534 CAATGAAAACACATGGACATAGG - Intergenic
1043260710 8:78192155-78192177 CAGTGAAAACACATGGACATAGG - Intergenic
1043474894 8:80596638-80596660 CATTGAAAAAATATGGGGCTGGG + Intergenic
1044374408 8:91452402-91452424 CAATGAAAACACATGGATATAGG - Intergenic
1044802556 8:95972272-95972294 GGCTGAAGACAGATGGTGCTGGG - Intergenic
1045685766 8:104710012-104710034 CACTGAAAACAGCTGAAGGATGG - Intronic
1045713575 8:105015142-105015164 CTCTTAAACCAGAGGGAGCTTGG - Intronic
1045742755 8:105381120-105381142 CAATGAAAACACATGGACATAGG - Intronic
1046217053 8:111162334-111162356 CTCAGAAAACAAATGGATCTTGG + Intergenic
1046523091 8:115350532-115350554 TGATGAAAACAAATGGAGCTTGG - Intergenic
1047172155 8:122504128-122504150 CTCTGAAAACAGAGGGAATTGGG + Intergenic
1047734935 8:127756967-127756989 CTCTGGAATCAGATCGAGCTGGG - Intergenic
1047790352 8:128197352-128197374 CACTGGAAACACAGGGAACTTGG + Intergenic
1047920105 8:129626762-129626784 TACTGAAAACAAAAGAAGCTTGG + Intergenic
1048357280 8:133663932-133663954 TCCTGAAATCAGAAGGAGCTTGG + Intergenic
1048588051 8:135793702-135793724 CCCTGCAAAAAAATGGAGCTGGG - Intergenic
1049152001 8:141041035-141041057 CACTGAAGGCCGAGGGAGCTGGG - Intergenic
1049230025 8:141477129-141477151 GCCTGAAGGCAGATGGAGCTGGG - Intergenic
1049492726 8:142913756-142913778 CAATGGAAGCAGAGGGAGCTGGG - Intronic
1049985536 9:947529-947551 CACTTAAAAGAAATGGAGATTGG + Intronic
1051770362 9:20571634-20571656 CAATGAAAACACATGGACCCGGG - Intronic
1052021749 9:23533007-23533029 CAGTGAAGTCAGATGGAGCCAGG - Intergenic
1052207113 9:25855598-25855620 CAATGAAAACAGATGGACACAGG - Intergenic
1055190906 9:73523117-73523139 CAATGAAAACACATGGACATAGG + Intergenic
1059926693 9:119216871-119216893 AACTGAAAACAGATGAAGTTTGG + Intronic
1061312128 9:129770653-129770675 TGCAGAAAACAGATGGATCTTGG - Intergenic
1185782140 X:2857945-2857967 CCCTGAACACAGATGGAGCTAGG + Intronic
1186308106 X:8286945-8286967 CACAGAAAACAAAAAGAGCTTGG + Intergenic
1187076422 X:15939574-15939596 CATTGAGAACACATGGAGATAGG - Intergenic
1188391028 X:29619527-29619549 CACTCAAAAAAGATGCAGATGGG - Intronic
1188483984 X:30662491-30662513 CACAGAAAACAGAAGGATTTTGG - Intronic
1189990761 X:46591911-46591933 CAATGAGAACAGATGGACATAGG - Intronic
1190623181 X:52309261-52309283 CAATGAAAACACATGGACATAGG + Intergenic
1192564024 X:72147729-72147751 CACTGAAGAGAGTTGGTGCTGGG - Intergenic
1192898602 X:75471007-75471029 AACAGAAAACAGATGGATTTTGG + Intronic
1193832836 X:86309207-86309229 TACAGAAGACAGATGGATCTTGG + Intronic
1194142755 X:90224927-90224949 CACTGAAAAGTGATGGACCCAGG - Intergenic
1194907330 X:99594183-99594205 CAATGAAAACACATGGACCCAGG - Intergenic
1196020089 X:110982287-110982309 CACTGAAGACAGACAGATCTAGG + Intronic
1196199352 X:112867965-112867987 CAGTGTTAAGAGATGGAGCTAGG + Intergenic
1196307533 X:114122027-114122049 CAATGAAAACACATGGACATAGG - Intergenic
1196927955 X:120652584-120652606 CAATGAAAACATATGGTGCAGGG + Intergenic
1197325908 X:125093193-125093215 CACAGAAATCAGCTGGTGCTAGG - Intergenic
1197599945 X:128517327-128517349 TACTGAAGACAGAGGAAGCTGGG + Intergenic
1199311190 X:146321644-146321666 CAATGAGAACATATGGAGATAGG + Intergenic
1200488513 Y:3794030-3794052 CACTGAAAAGTGATGGACCCAGG - Intergenic
1201577511 Y:15477023-15477045 CTGTGAATACAGATGAAGCTTGG + Intergenic
1202104677 Y:21350664-21350686 CAATGAAAACACATGGACATAGG - Intergenic