ID: 1074324303

View in Genome Browser
Species Human (GRCh38)
Location 10:112433101-112433123
Sequence AAATTTCAACAAATGTATTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1348
Summary {0: 1, 1: 0, 2: 3, 3: 129, 4: 1215}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074324300_1074324303 22 Left 1074324300 10:112433056-112433078 CCTCTAGTCCCAATTATTTAAAT 0: 1
1: 0
2: 0
3: 21
4: 245
Right 1074324303 10:112433101-112433123 AAATTTCAACAAATGTATTAAGG 0: 1
1: 0
2: 3
3: 129
4: 1215
1074324297_1074324303 30 Left 1074324297 10:112433048-112433070 CCTCCCAACCTCTAGTCCCAATT 0: 1
1: 0
2: 2
3: 17
4: 207
Right 1074324303 10:112433101-112433123 AAATTTCAACAAATGTATTAAGG 0: 1
1: 0
2: 3
3: 129
4: 1215
1074324299_1074324303 26 Left 1074324299 10:112433052-112433074 CCAACCTCTAGTCCCAATTATTT 0: 1
1: 0
2: 4
3: 59
4: 603
Right 1074324303 10:112433101-112433123 AAATTTCAACAAATGTATTAAGG 0: 1
1: 0
2: 3
3: 129
4: 1215
1074324302_1074324303 13 Left 1074324302 10:112433065-112433087 CCAATTATTTAAATAAAAACAAA 0: 1
1: 4
2: 33
3: 394
4: 3377
Right 1074324303 10:112433101-112433123 AAATTTCAACAAATGTATTAAGG 0: 1
1: 0
2: 3
3: 129
4: 1215
1074324301_1074324303 14 Left 1074324301 10:112433064-112433086 CCCAATTATTTAAATAAAAACAA 0: 1
1: 3
2: 19
3: 315
4: 2447
Right 1074324303 10:112433101-112433123 AAATTTCAACAAATGTATTAAGG 0: 1
1: 0
2: 3
3: 129
4: 1215
1074324298_1074324303 27 Left 1074324298 10:112433051-112433073 CCCAACCTCTAGTCCCAATTATT 0: 1
1: 0
2: 1
3: 28
4: 295
Right 1074324303 10:112433101-112433123 AAATTTCAACAAATGTATTAAGG 0: 1
1: 0
2: 3
3: 129
4: 1215

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074324303 Original CRISPR AAATTTCAACAAATGTATTA AGG Intronic
900024685 1:260801-260823 ATATTTCGACAAATGCATTGTGG - Intergenic
900028294 1:350206-350228 ATATTTCGACAAATGCATTGTGG - Intergenic
900746741 1:4365907-4365929 ACATTTCAACATATGCATTTGGG - Intergenic
901558303 1:10049178-10049200 TAATTTCAACAAATATTTTTGGG + Intronic
901908877 1:12438185-12438207 GAATTTCAACATATGAATTCTGG - Intronic
902068267 1:13708018-13708040 AAATTTAATCAAAAGTATGAGGG + Intronic
902907786 1:19571705-19571727 AAGTTTCAACATATGAATTGAGG - Intergenic
903109873 1:21122918-21122940 AAAGTTAAAATAATGTATTAGGG + Intronic
903544622 1:24116164-24116186 AAGTTTCAACATATGAATTTTGG + Intergenic
903697247 1:25217039-25217061 AAGCTTCAACAAATACATTAAGG - Intergenic
904428931 1:30449481-30449503 ATATTAGAAAAAATGTATTAGGG + Intergenic
905706817 1:40066528-40066550 CAATTTCAATAAATATGTTAGGG + Intronic
906421740 1:45674229-45674251 AAAATTCAAAAGATGTTTTAAGG + Intronic
906736358 1:48132858-48132880 AAATTTTAAAAAATGATTTAAGG - Intergenic
906866521 1:49427042-49427064 AAATGTCAACAGATGTAGTGAGG + Intronic
907546795 1:55267954-55267976 AAATTTCAGCAAATGCAGTAAGG - Intergenic
907656682 1:56350152-56350174 AGATTTCAACACATGAATTTGGG + Intergenic
908657887 1:66407038-66407060 AAAGCCCAACAAATGTTTTAGGG + Intergenic
908714702 1:67056592-67056614 AAGTTTCAACATATGAATTTTGG + Intergenic
908962967 1:69723944-69723966 AAATTTCAACATATAAATTTTGG + Intronic
909177169 1:72375704-72375726 AAATTAAAACAAATGGAATATGG - Intergenic
909233549 1:73121827-73121849 AAATTTCAACATATGAATTTTGG + Intergenic
909239414 1:73192975-73192997 GGATTTCAACAAATGAATTTTGG + Intergenic
909298019 1:73975756-73975778 AAATTTCAAGTAATGCAATAAGG - Intergenic
909351993 1:74664999-74665021 AGATTTCAACATATGAATTTTGG - Intronic
909353203 1:74677681-74677703 AAATATCAACACATGAATTTTGG - Intergenic
909364753 1:74806251-74806273 TAATTTCAACATATGAATTTTGG + Intergenic
909535746 1:76734142-76734164 GAATTTCAACATATGAATTATGG + Intergenic
909735483 1:78954625-78954647 AAATTTCAACAAAGAAAATAGGG + Intronic
909933654 1:81527300-81527322 AAGTTTCAACATATGAATTTTGG - Intronic
910063633 1:83124655-83124677 AGATTTCAACATATGAATTTAGG + Intergenic
910069829 1:83198819-83198841 AAAATAGATCAAATGTATTAAGG - Intergenic
910399802 1:86827184-86827206 ACATTTCAACATATGAATTTTGG - Intergenic
911099879 1:94087161-94087183 AGATTTCAACATATGAATTTTGG + Intronic
911246735 1:95526173-95526195 AAGTTTCAACACATGAATTTTGG - Intergenic
911588838 1:99722619-99722641 GAATTTCATCAAATGTCTTTTGG - Intronic
911631432 1:100187799-100187821 ATATTTCTACAAATATTTTATGG + Exonic
911711084 1:101073809-101073831 AAATTTCAAGAAAAGTATAGGGG - Intergenic
911713063 1:101097111-101097133 AACTTTCAACATATGAATTTGGG + Intergenic
911728971 1:101272020-101272042 AAATTTCAAAAAAAGAAATAGGG - Intergenic
912019474 1:105088949-105088971 AAATGTCAACAACTGTAGAATGG - Intergenic
912025026 1:105159376-105159398 GAATTTCAACATATGAATTTTGG + Intergenic
912072910 1:105836398-105836420 ATATTTCAGAAAATATATTATGG - Intergenic
912080296 1:105927924-105927946 AAATTTTAACAAACGGTTTATGG + Intergenic
912092059 1:106090833-106090855 AAATGTCAACATATGAATTTTGG - Intergenic
912143493 1:106761240-106761262 AATTTTTAAAAAATGCATTAAGG + Intergenic
912215389 1:107605210-107605232 AAATTTCAACATGGGTTTTAAGG - Intronic
912362628 1:109107585-109107607 AAATTTCAAAAAGAATATTAAGG + Intronic
912547552 1:110461783-110461805 AAATTTCAACACATAAATTCAGG + Intergenic
912740829 1:112195503-112195525 ACATTTAAAAAAATGTATCAAGG + Intergenic
912959435 1:114182057-114182079 GAATTTCAACACATGAATTTTGG + Intergenic
913240113 1:116822526-116822548 AAATTTCAACATATGAGTTTTGG + Intergenic
913479221 1:119269787-119269809 AAATTTCAAATAATGAATTAAGG + Intergenic
914325523 1:146611684-146611706 AGATTTCAACATATGAATTTGGG + Intergenic
914503929 1:148272187-148272209 AACTTTCAACATATGAATTCAGG + Intergenic
914748670 1:150517466-150517488 GGATTTCAACAAATGCATTTGGG - Intergenic
914819745 1:151091775-151091797 AAATTTAAAAAATTGTTTTAGGG - Intronic
914976758 1:152372031-152372053 AATTTTCAACAGATGTACAAAGG + Intergenic
915010800 1:152684623-152684645 AAATTACAACAAATGGATATAGG - Intergenic
915101461 1:153503821-153503843 AAATTTCAACATGAGTTTTAGGG - Intergenic
915754823 1:158249544-158249566 GAATTTCAACATATGAATTTTGG + Intergenic
916570414 1:166021023-166021045 AAATTTCAACAATTGCATTGAGG - Intergenic
916672218 1:167032157-167032179 TAATTTCAACAAATGCAAAATGG + Intergenic
916689445 1:167176558-167176580 GAATTTCAACATATGTATTCTGG + Intergenic
916766368 1:167864298-167864320 AAATTTCAAGAAAGGATTTAAGG + Intronic
917439960 1:175059374-175059396 AAATCTCAAAAAATATATAATGG + Intergenic
917757508 1:178117521-178117543 AACTTTCAACATATGAATTGGGG - Intronic
918585194 1:186178890-186178912 AAATTTCAAGACATTTATTTTGG + Intronic
918634416 1:186757754-186757776 AAATCTTCACAAATGTATTGTGG - Intergenic
918635431 1:186768602-186768624 AAATTTCAGAAAATATATGAAGG - Intergenic
918815727 1:189179280-189179302 AAATGTCATCAAATAGATTAAGG - Intergenic
918923237 1:190743796-190743818 AAATTACTAAAAATGTATTAAGG + Intergenic
919023483 1:192138014-192138036 AAAATTCAACACATGGATTTTGG + Intergenic
919146183 1:193638439-193638461 AAATTTCAACACATGAATTTTGG + Intergenic
919170754 1:193950893-193950915 ATATTTCAACATATGAATTTTGG - Intergenic
919267421 1:195288419-195288441 AAATTTCAACAAGTTCTTTATGG + Intergenic
919421897 1:197379925-197379947 CAAATTCAACAACTGAATTAAGG + Intronic
919703031 1:200651305-200651327 AGATTTCAACATATGAATTTAGG - Intronic
919985617 1:202672240-202672262 GAATTTCAACATATGAATTTTGG - Intronic
920167072 1:204043603-204043625 AAGTTTCAACACATGAATTTAGG + Intergenic
920243428 1:204570465-204570487 AAGTTTCAACATATGAATTTTGG + Intergenic
920634518 1:207686757-207686779 AGATTTCAACATATGGATTTGGG - Intronic
920740731 1:208578989-208579011 AGATTTCAACACATGAATTGGGG - Intergenic
921295836 1:213702294-213702316 AATTTTTAAAAAATGTTTTAAGG + Intergenic
921336457 1:214091918-214091940 AAGTTTCAACAACTGAATTTTGG - Intergenic
921609977 1:217200721-217200743 GATTTTCCACAAATGTGTTAAGG - Intergenic
921843075 1:219848926-219848948 AAATTTAAAGAAAGGTATTTAGG + Intronic
921878985 1:220232237-220232259 AACTTTCAACACATGTTTTTTGG - Intronic
921894977 1:220390474-220390496 AAGTTTCAACATATGAATTTTGG + Intergenic
922112166 1:222570780-222570802 AAATTCCAACAAATATTTAAAGG + Intronic
922355481 1:224771242-224771264 AAGTTTTAAAAAATGTTTTAAGG + Intergenic
922396348 1:225205182-225205204 GAATTTCAACACATGGATTTTGG - Intronic
922689951 1:227680367-227680389 AAATTTCAAAAAAGGATTTAAGG + Intergenic
922848909 1:228714520-228714542 AAATTTCAACAAGTCAATTTTGG + Intergenic
922983429 1:229848021-229848043 AAATTTCTACAAATGCATGTTGG - Intergenic
923068070 1:230538395-230538417 AAATTTTAACATATGGATTTGGG + Intergenic
923517251 1:234708223-234708245 GAATTTCAACATATGAATTTTGG - Intergenic
923848640 1:237766903-237766925 AAATTTTAACAAATGCACTCTGG + Intronic
923927774 1:238654146-238654168 TAAATGCAACAAATGTGTTAGGG - Intergenic
924187188 1:241505210-241505232 AACTTTAAAAAATTGTATTAGGG - Intronic
924378209 1:243435651-243435673 AATTTTCAACAACTGATTTATGG + Intronic
924938578 1:248793221-248793243 TAATTTCAACATATGAATTTTGG - Intergenic
1063051976 10:2460476-2460498 AAATTTTAAAAAATATATAAGGG - Intergenic
1063335399 10:5208009-5208031 AAATTTCCACAATTGTGTTCTGG - Intronic
1063748663 10:8916987-8917009 AAACTTATACAAATGTTTTAAGG + Intergenic
1064298035 10:14096079-14096101 AGATTTCAACATATGAATTTTGG - Intronic
1064714280 10:18160509-18160531 AACTTTCAACCAATCTAGTAAGG - Intronic
1064741605 10:18440285-18440307 AAGTTTCAACATATGAATTTTGG + Intronic
1064773015 10:18744005-18744027 AAAATTAATCAAATTTATTAAGG - Intergenic
1064912425 10:20416985-20417007 AAATTTCAACATATGAATGGGGG - Intergenic
1064920957 10:20517633-20517655 AAATTTCAAGAAAAGTATTTTGG + Intergenic
1065460360 10:25956230-25956252 AAGTTTCAACACATGAATTTTGG + Intronic
1065869362 10:29943142-29943164 AAATTTGGAAAAAAGTATTACGG + Intergenic
1066185018 10:33001807-33001829 AAATTTCAACACCTGAATTTTGG + Intronic
1066245541 10:33580256-33580278 AAATTGCAAACAATGTTTTAGGG - Intergenic
1066692870 10:38048290-38048312 AAATAACATCAAATGTATTGTGG + Intronic
1066999904 10:42600813-42600835 AAATAACATCAAATGTATTGTGG - Intronic
1067968275 10:50939907-50939929 AAATTTCAACATATGAATTTGGG - Intergenic
1068258601 10:54546845-54546867 AAATTTCAAAATATGAATTGAGG - Intronic
1068265397 10:54642038-54642060 ATATTTTAACATATGAATTATGG - Intronic
1068327273 10:55509610-55509632 CAATTTACACAAATGTTTTACGG + Intronic
1068345815 10:55776451-55776473 AGATTTCAACATATGAATTTCGG - Intergenic
1068355989 10:55908943-55908965 AAATTTCAATAAATGGTTAATGG - Intergenic
1068439611 10:57033959-57033981 AAATTTTAATAAATTTATTCAGG + Intergenic
1068525829 10:58128294-58128316 AAATTTCAACAATTGTTTTGTGG - Intergenic
1068625994 10:59248117-59248139 TATTTTTAACAACTGTATTAGGG - Intronic
1068755972 10:60653432-60653454 AATTTTCAACAAAAATATCAAGG - Intronic
1068758919 10:60685339-60685361 AAATTTCTACAACTGTGTTCTGG - Intronic
1068927790 10:62558021-62558043 AAGTTTCAACATATGAATTTTGG - Intronic
1068934383 10:62621901-62621923 AAATACAAACAAATGCATTAAGG + Intronic
1069138431 10:64794502-64794524 AAATTTAAACAAATCATTTAGGG + Intergenic
1069882046 10:71599156-71599178 AAATGTCAACAAATGTTATCAGG - Intronic
1071047094 10:81393362-81393384 AAATTTCTACATATGTTATAAGG - Intergenic
1071180488 10:82977926-82977948 AAATTTCAATAAATTTATCAAGG - Intronic
1071281664 10:84109495-84109517 AAATTTCAAAAAAGGATTTAAGG + Intergenic
1071584575 10:86807151-86807173 CACTTTCAACAAATGTATCTAGG + Intronic
1071801648 10:89069884-89069906 AGAATTCAACAAATGTCTTAAGG - Intergenic
1071934481 10:90512707-90512729 AAATTTCAACATATAAATTTGGG - Intergenic
1071998434 10:91169912-91169934 AAAATTAAACAAATGGATCATGG + Intronic
1072000452 10:91190302-91190324 AGATTTCAACATATGAATTTTGG + Intronic
1072100134 10:92221593-92221615 AAATTTCAACATGTGCATTTTGG - Intronic
1072331265 10:94354659-94354681 AAATTTATAAAATTGTATTAGGG - Intronic
1072334511 10:94385545-94385567 AAATTTCAAGAAAGGATTTAAGG + Intergenic
1072774437 10:98176052-98176074 GATTTTCAAGAAATGTATAAAGG - Intronic
1072991933 10:100204151-100204173 GAATTTCAACATATGTATTTTGG + Intronic
1073827570 10:107342095-107342117 AAATACCAACAAAGGTTTTATGG + Intergenic
1074324303 10:112433101-112433123 AAATTTCAACAAATGTATTAAGG + Intronic
1074482463 10:113836990-113837012 ACATTTTAAAAAATGTAATAAGG - Intronic
1074637237 10:115334080-115334102 AAATTTCAACACATGATTTATGG + Intronic
1074723556 10:116284904-116284926 AGATTTCAACATATACATTAGGG + Intergenic
1075247402 10:120835461-120835483 AAATTTTCAAAAATGTATCATGG - Intergenic
1075378901 10:122002280-122002302 AGATTTCAACATATGAATTTGGG + Intronic
1075518157 10:123126133-123126155 ACATTTCAACATATGAATTTTGG - Intergenic
1075773059 10:124956794-124956816 AAATTTCAAAACCTGTATAAAGG + Intronic
1075829086 10:125389444-125389466 ATATTTCTTCAAATGTATTTTGG + Intergenic
1075850566 10:125583174-125583196 AATTTACAACATATGTATCAGGG - Intronic
1076038408 10:127221293-127221315 AAATTGCAGAAAATGCATTATGG + Intronic
1076366401 10:129923502-129923524 AGATTTCAACAAAGGTGCTAAGG + Intronic
1076962355 10:133774686-133774708 ATATTTCGACAAATGTATTGTGG + Intergenic
1078120685 11:8505764-8505786 AAATGTGAACAAATGAATGAAGG + Intronic
1078258939 11:9685970-9685992 AAGTTTCAACATATGAATTTTGG + Intronic
1078418453 11:11185753-11185775 AAATCACTACAAATGTATAACGG - Intergenic
1078471918 11:11595176-11595198 AGATTTCAACATATGAATTTTGG - Intronic
1078618544 11:12886864-12886886 AAACATCAACATATCTATTAGGG - Intronic
1078739232 11:14051123-14051145 AAACTTCAACAAATGGATTTTGG - Intronic
1078843677 11:15102413-15102435 AAATTTCAACATATGAGTTTTGG + Intergenic
1079051199 11:17161621-17161643 AAATTGGAACTAATGTATTTAGG + Intronic
1079287230 11:19146875-19146897 AAAGTTTAAGAAATTTATTAAGG + Intronic
1079400284 11:20101399-20101421 AAATTGCAACAGATGTATCGTGG - Intronic
1079613172 11:22458061-22458083 AAATTTCATCACATGAATTTTGG + Intergenic
1079664590 11:23088489-23088511 AGATTTCAACAAATGTCCTGAGG - Intergenic
1079818859 11:25098289-25098311 AGATTTCAACATATGAATTTTGG - Intergenic
1079880963 11:25925805-25925827 AGATTTCAACATATGGATTTTGG - Intergenic
1080028840 11:27639566-27639588 ATATCTCAACATATGTCTTAAGG - Intergenic
1080104540 11:28498164-28498186 ACATTTCAACACATGAATTCCGG + Intergenic
1080420860 11:32109299-32109321 AAGTTTCAGCAAATGAATTTTGG - Intergenic
1080695011 11:34595922-34595944 AAATGTCAACATATGAATGAGGG - Intergenic
1080861872 11:36157083-36157105 CAATTTAAACAATTCTATTAAGG + Intronic
1081188866 11:40079280-40079302 AATTTTCAACACATGTTTTGTGG - Intergenic
1081535103 11:43990558-43990580 AAGTTTCAACATATGAATTTGGG + Intergenic
1081703582 11:45167051-45167073 CAATTTCATCAAATGTAGGAAGG + Intronic
1083002123 11:59302120-59302142 CAATTTCAACAGATTTGTTAGGG + Intergenic
1083045037 11:59726830-59726852 AAAAATCAACAAATGTGTGATGG + Intronic
1083089649 11:60186484-60186506 AAATTTCAAGAAAGGATTTAAGG + Intergenic
1084076392 11:66781075-66781097 AAATTTCATGAAAAATATTAAGG - Intronic
1084293149 11:68189531-68189553 TAATTTCCACAAATGTTTCATGG - Intronic
1084523558 11:69681734-69681756 AAATTTAAAAAAAAGTATTCTGG - Intergenic
1085068690 11:73521939-73521961 AGAGTTCAACAAAGGTGTTAAGG + Intronic
1085189981 11:74611363-74611385 AAATTATAACATATGTTTTAAGG + Intronic
1085445963 11:76601056-76601078 AAGTTTCAACATATGAATTTTGG - Intergenic
1085509234 11:77078339-77078361 AATTTTCAACAAAAGTACCAAGG - Intronic
1085638004 11:78172940-78172962 CATTTTAAACAAATCTATTACGG - Exonic
1085883807 11:80498951-80498973 AGATTTCAACAGATGAATTCTGG - Intergenic
1085884025 11:80500939-80500961 AGATTTCAACATATGGATTTTGG - Intergenic
1085885435 11:80516405-80516427 ATATTTCAAAAATTGTAATAAGG + Intergenic
1086111699 11:83206463-83206485 AGATTTCAACATATTTATTTTGG - Intronic
1086275385 11:85122328-85122350 AAAGGTTAAGAAATGTATTAGGG + Intronic
1086609047 11:88731501-88731523 AATGTTCAACAAATGTTTAATGG + Intronic
1086649328 11:89268262-89268284 AAACTGCAAGAAATGTAGTATGG - Intronic
1086775479 11:90826212-90826234 AAATGCCAACAACTGTGTTAAGG - Intergenic
1086790408 11:91030588-91030610 AGGTTTCAACAAATGAATTTGGG - Intergenic
1086973684 11:93109802-93109824 AAATTTCAAGAAAGGATTTAAGG - Intergenic
1086986552 11:93256553-93256575 AAAATTCTACAAATGTAGAAAGG + Intergenic
1087097167 11:94330330-94330352 AAATTCCAACATATGAATTTTGG + Intergenic
1087224072 11:95578477-95578499 AAGTTTCAACATATGAATTTGGG + Intergenic
1087710625 11:101545671-101545693 AAATTATAAGAAATGTATTAAGG - Intronic
1087813288 11:102631611-102631633 GAATTTCAACATATGAATTTGGG - Intergenic
1087814963 11:102648349-102648371 AAGTTTCAACACATGAATTTGGG - Intergenic
1087859052 11:103130754-103130776 TATTTTAAACAAATTTATTAGGG - Intronic
1087894562 11:103573087-103573109 AAATTTCAAGAAAGGATTTAAGG + Intergenic
1087981722 11:104622270-104622292 GAATTTCAACAAATGAATTTTGG + Intergenic
1087984032 11:104655371-104655393 AACTATCTACAAATATATTAAGG - Intergenic
1088040814 11:105379644-105379666 AAGTTTCAACATATGGATTTTGG - Intergenic
1088051810 11:105525454-105525476 AAATTACATTAAATGTACTATGG + Intergenic
1088160010 11:106857416-106857438 GAATTTCAACATATGGATTTTGG + Intronic
1088176635 11:107059986-107060008 AAATTTAAAAAAATATATTTAGG - Intergenic
1088920047 11:114254065-114254087 AAATGTCACCAAATGCATTAAGG - Intergenic
1089241886 11:117088461-117088483 AAAAGTCAAAAGATGTATTAAGG + Intronic
1089827045 11:121287458-121287480 AGATTTCAACATATGAATTTGGG + Intergenic
1089952280 11:122539880-122539902 AAATCTTAACAAATGTAAGAAGG + Intergenic
1090131517 11:124147002-124147024 AAATTTCCACAACTGTGTTCCGG - Exonic
1090357897 11:126152333-126152355 AAATTACAACAAATGTAGCATGG - Intergenic
1090444204 11:126749322-126749344 AAATACCAACAAATGTTCTAGGG - Intronic
1091053132 11:132392936-132392958 TAATTTCAACACATGAATTTTGG - Intergenic
1091814775 12:3429358-3429380 AAATTTCAAGAAAGGATTTAAGG - Intronic
1091876922 12:3942644-3942666 TAATTTCTATAATTGTATTATGG - Intergenic
1092623555 12:10301095-10301117 AAATTTCATAAAATGAATGAAGG + Intergenic
1092768959 12:11879164-11879186 AAATTTCAAAAAATGTAACAGGG + Intronic
1092888377 12:12945748-12945770 AAACTTCAACAAAAAGATTAGGG - Intronic
1093165142 12:15796573-15796595 AAATTCTCAGAAATGTATTAAGG - Intronic
1093227738 12:16505769-16505791 AGGTGTCAACAAATGTATTTAGG - Intronic
1093280414 12:17188538-17188560 AAATTTAGACAAATATATCACGG - Intergenic
1093716860 12:22392475-22392497 AAACATCAACAAATGAATTTAGG + Intronic
1094074005 12:26452513-26452535 AATTTCCAACACATGCATTATGG - Intronic
1094080662 12:26531270-26531292 ACATTTCAATAAATGTACTGAGG + Intronic
1094244415 12:28272288-28272310 AAAGCTCAACAAATTAATTATGG + Intronic
1095163857 12:38948535-38948557 AAATTTCAATATATGAATTTGGG + Intergenic
1095627748 12:44337413-44337435 AAGTTTCAACAAATTAATTTGGG + Intronic
1096911712 12:54990685-54990707 AAGTTTCAACATATGAATTTGGG + Intergenic
1097259323 12:57707025-57707047 AAATTTAGACAAATGAATAATGG - Intronic
1097770218 12:63575078-63575100 AATTTTTAAAAAATGTTTTAAGG - Intronic
1097786098 12:63761140-63761162 AAATTTAAAAAATTGTATTAAGG + Intergenic
1097982425 12:65748089-65748111 AAGTTTCAACATATGAATTTTGG - Intergenic
1098053901 12:66483292-66483314 ATATTTAAAAAAATGTATTGGGG - Intronic
1098248157 12:68541285-68541307 AAATTTCAAGAAAAGATTTAAGG + Intergenic
1098639602 12:72823566-72823588 AAATTTCAAGAAAGGATTTAAGG - Intergenic
1098714951 12:73818665-73818687 AAATTTTAACATATGAATTCAGG - Intergenic
1098754069 12:74335532-74335554 AGATTTCAGCAACTGTGTTAAGG - Intergenic
1098914372 12:76241743-76241765 AAGTTTCAACATATGAATTTGGG - Intergenic
1098950852 12:76639214-76639236 AGATTTCAACATATGAATTTTGG + Intergenic
1099083610 12:78217767-78217789 AAATGTGCACAAATATATTAGGG - Intergenic
1099158755 12:79212951-79212973 AAATATCAACAACAGTATTTTGG + Intronic
1099161456 12:79246743-79246765 AAGTTTCAACATATGAATTTTGG + Intronic
1099319429 12:81126562-81126584 AAATTTTAACATAAGTATCAAGG + Intronic
1099518284 12:83626600-83626622 AAATGTTAACAAATGTACAATGG - Intergenic
1099706985 12:86167790-86167812 AAATTTCAACACATGAACTTTGG + Intronic
1099753856 12:86814640-86814662 AGATTTCAACACATGAATTTCGG - Intronic
1100030775 12:90187914-90187936 AGATTTCAACATATGGATTTGGG + Intergenic
1100149114 12:91714009-91714031 AAATTTCAGCACATGAATTTGGG + Intergenic
1100217023 12:92461621-92461643 AAATTTCAACATATGAATTTTGG + Intergenic
1100476522 12:94940432-94940454 AAATTTCAACATATGAATTCTGG - Intronic
1100552852 12:95662558-95662580 AAACTTCAAAAAAGCTATTATGG + Intronic
1100598378 12:96091011-96091033 AAATTTCAACATATGAATTTTGG - Intergenic
1100694526 12:97077587-97077609 AAAATTCAACAAAATTATTTTGG + Intergenic
1100696689 12:97101464-97101486 GAATTTCAACATATGAATTTTGG + Intergenic
1100727074 12:97419931-97419953 ATATTTCAAAAATTTTATTAAGG - Intergenic
1100765735 12:97863467-97863489 AGATTTCAACACATGAATTTGGG - Intergenic
1100800466 12:98225283-98225305 AGATTTCACCAAATGAATTATGG - Intergenic
1100844004 12:98641472-98641494 AAATGTTTACAAATGTCTTATGG + Intronic
1100861082 12:98808035-98808057 AAAACTCAAAAAATGTTTTAGGG + Intronic
1101000217 12:100350151-100350173 AAATTTCATTTAATGTATTTGGG + Intergenic
1101051834 12:100871892-100871914 AACTTTCAACATATGAATTTTGG + Intronic
1101412012 12:104477480-104477502 AGGTTTCAACACATGAATTAGGG - Intronic
1101708043 12:107239228-107239250 AAATGCCAACAACTGTACTAAGG + Intergenic
1102602407 12:114041676-114041698 TAATTTTGACAAATGTATCATGG - Intergenic
1102734137 12:115143043-115143065 GAATTTCAACATATGAATTTTGG - Intergenic
1102817666 12:115880827-115880849 ATATTTCAACACATGAATTTTGG - Intergenic
1103070335 12:117936024-117936046 AAAGTTCAATAAATGGAATAAGG - Intronic
1104119943 12:125789524-125789546 AGATTTCAACTTATGAATTAGGG - Intergenic
1104245766 12:127039937-127039959 AAATTCCAAGAAATGTAATGGGG - Intergenic
1104370898 12:128223083-128223105 AAACTTCAGCAAATGAATTTGGG + Intergenic
1105570599 13:21599303-21599325 TAATTTCAAAAAATGTATCAAGG + Intronic
1105959692 13:25320501-25320523 AAAATGCAAAACATGTATTAAGG - Intronic
1106127669 13:26913592-26913614 AGATTTCAACATATGAATTCTGG - Intergenic
1106203965 13:27571708-27571730 ATATTTTAAAAAAAGTATTAGGG + Intronic
1106592367 13:31108979-31109001 AGATTTCAACATATGAATTTGGG + Intergenic
1106678937 13:31990044-31990066 AAGTTTCAACATATGAATTTTGG - Intergenic
1106935562 13:34714983-34715005 ATATTTCAACAAATGGCTAATGG - Intergenic
1107239815 13:38218884-38218906 GAATTTCAACATATGAATTTTGG + Intergenic
1107618450 13:42198024-42198046 AAATATTAAGAGATGTATTAAGG - Intronic
1107645630 13:42491800-42491822 AGATTCCAACAAATGAATTTTGG + Intergenic
1107817629 13:44258368-44258390 AGATTTCAACATATGAATTTTGG - Intergenic
1107925093 13:45251942-45251964 AAATTTAAAAAACTGTTTTAAGG - Intronic
1108086808 13:46802166-46802188 AAATTTCCACATATGAATTTTGG - Intergenic
1108161893 13:47649115-47649137 AAGTTTCAACACATGAATTTTGG + Intergenic
1108400438 13:50036556-50036578 AAATATTAACAAATGTGTCAGGG + Intergenic
1108614009 13:52113733-52113755 AAATTTCAACATATACATTTGGG - Intronic
1108725552 13:53176553-53176575 AAATATCAACATATGAATTTTGG + Intergenic
1108783631 13:53867899-53867921 AGATTTCAACATATGAATTCAGG + Intergenic
1108886538 13:55191839-55191861 TAATTTCAACAAATATTTTATGG + Intergenic
1108900130 13:55392341-55392363 CCATTTCTACAAATGTAATATGG + Intergenic
1108915142 13:55600619-55600641 AATTTTCTGGAAATGTATTAAGG + Intergenic
1109050045 13:57468585-57468607 AAATTTCACAAAGTGTATTGCGG - Intergenic
1109117462 13:58406804-58406826 GAATTTCAACATATGAATTTTGG - Intergenic
1109198335 13:59403911-59403933 AAATTTAAAGAAATATATAATGG + Intergenic
1109677262 13:65694290-65694312 AGATTTCAACATATGGATTTAGG - Intergenic
1109874273 13:68378897-68378919 AAATTTCAACACATGAATTTTGG + Intergenic
1110169537 13:72484319-72484341 AGATTTCAACATATGAATTCTGG + Intergenic
1110407331 13:75165431-75165453 AAGTTTCAACATATGAATTTTGG - Intergenic
1110446132 13:75583830-75583852 AAATTTTAACAAATTGCTTAAGG + Intronic
1110656748 13:78009040-78009062 AAAGTTCTACAAATATATTAGGG + Intergenic
1110695458 13:78482982-78483004 AAATTAAAAAAAATGTATTTTGG - Intergenic
1110700299 13:78539576-78539598 AAATTTCAATAATTGTGTTCAGG + Intergenic
1111031125 13:82600753-82600775 AAGTTTCAACACATGAATTTTGG - Intergenic
1111033509 13:82638605-82638627 AAATAACAAAAAATGTAATATGG + Intergenic
1111179847 13:84650227-84650249 CATTTTCAATAAATGAATTAGGG + Intergenic
1111203235 13:84967335-84967357 AAATTTTGAAAAATGTATTTTGG + Intergenic
1111327052 13:86712313-86712335 AAATTGACACAAATGTGTTACGG + Intergenic
1111341314 13:86890372-86890394 ATATTTCAACATATGAATTTTGG - Intergenic
1111497419 13:89070483-89070505 AGATTTTAACAAATGGATTTAGG - Intergenic
1111960742 13:94807490-94807512 AAATTGCCACAAATATCTTATGG + Intergenic
1112113957 13:96332830-96332852 AACTTTCAACATATGAATTTGGG - Intronic
1112311853 13:98324983-98325005 AAATTTCAACTACTGTGTTAAGG - Intronic
1112390462 13:98978960-98978982 AAATTAAAACAGAGGTATTAAGG + Intronic
1112646732 13:101341778-101341800 GAAATTCAACAAATGAATTTGGG - Intronic
1113212007 13:107994298-107994320 AGATTTCAACATATGCATTTTGG + Intergenic
1113476406 13:110585037-110585059 AAATCTCAACAGATGTTTTGTGG - Intergenic
1113810105 13:113135629-113135651 AAATTTTAACATATGTATGGGGG + Intronic
1114366080 14:22028500-22028522 AGATTTCAACATATGAATTTGGG - Intergenic
1114766891 14:25382754-25382776 AAATTTCAACATATGTGTTTTGG + Intergenic
1114803177 14:25802256-25802278 AAAAGTCAACAACTGTTTTATGG - Intergenic
1115063920 14:29231028-29231050 TAATTTGAAAAAATATATTAAGG - Intergenic
1115106641 14:29769904-29769926 AGGTTTCAACATATGAATTATGG - Intronic
1115432192 14:33332151-33332173 AAATGTAAACAAAATTATTACGG + Intronic
1115584309 14:34794788-34794810 AAAGTTCCCCAAATGCATTAAGG + Exonic
1115995863 14:39195129-39195151 GAATTTCAACATATGAATTTGGG + Intergenic
1116012919 14:39371979-39372001 AAATTTTAGCAAAAGTCTTAAGG + Intronic
1116081566 14:40180443-40180465 AAGTATTAACAAATGTAATAGGG + Intergenic
1116118427 14:40689897-40689919 AAAATTGAACAAATGCATTAAGG - Intergenic
1116127703 14:40809325-40809347 AGATTTCAACATATGAATTTTGG - Intergenic
1116214650 14:41997462-41997484 AGACTTCAACAAATGAATTTTGG - Intergenic
1116386770 14:44340453-44340475 AGATTTCAACAAATGAATTCTGG + Intergenic
1116567353 14:46465929-46465951 AAATTGCAAAAAATATGTTAAGG - Intergenic
1116582235 14:46656852-46656874 GAATTTCAACATATGAATTTTGG - Intergenic
1116659905 14:47696722-47696744 AAACTTCAACATATGAATTTGGG - Intergenic
1116692045 14:48120799-48120821 ATATTTTCAAAAATGTATTAAGG - Intergenic
1116734947 14:48677524-48677546 AAGTTTCAACATATGAATTTAGG - Intergenic
1116786022 14:49289701-49289723 AAATTTCAACATGAGTTTTAGGG - Intergenic
1117025120 14:51611234-51611256 AAATTTCCTTAAAGGTATTATGG + Intronic
1117106468 14:52402114-52402136 AAATTTCAACAAATGCTATTGGG + Intergenic
1117160662 14:52986315-52986337 AAATTTCAACATGTGGATTTGGG + Intergenic
1117427603 14:55617207-55617229 TAATTTTAACAAATATATTCAGG - Intronic
1117462769 14:55962647-55962669 AAGTTCCAACAAATGAATTTTGG - Intergenic
1117537439 14:56715259-56715281 ACTTTTCAACAAATGTAAAAAGG + Intronic
1117678441 14:58178897-58178919 AGATTTCAACACATGAATTTTGG + Intronic
1117894451 14:60466677-60466699 AAATTTCAAAAAAAGTGTTCTGG - Intronic
1117941383 14:60969948-60969970 AAATATTTACAAATGTATAAAGG - Exonic
1118156223 14:63244817-63244839 AATTTTCAACAAATAAATAAAGG + Intronic
1118160273 14:63281765-63281787 CAATCACATCAAATGTATTAAGG + Intronic
1119053533 14:71394257-71394279 AAATTTAAACTAAGGTAATAGGG - Intronic
1119181387 14:72607522-72607544 AGATTTCAACATATGGATTTTGG + Intergenic
1120394642 14:83953904-83953926 GAATTTCAACATGTGAATTATGG - Intergenic
1120462366 14:84813774-84813796 AAAGATCAAAAAATGTATTCAGG + Intergenic
1120628493 14:86859098-86859120 AAATTCAAACAAATGGATCATGG - Intergenic
1120889241 14:89477004-89477026 AAATTTCAAAAATAGTTTTAGGG + Intronic
1121200183 14:92110316-92110338 ACATTTCAACAAATGAATTTTGG + Intergenic
1121468708 14:94134984-94135006 GAGTTTCAACAAAGGTACTAAGG + Intergenic
1121694235 14:95899830-95899852 AGATTTCAACATATGAATTTTGG + Intergenic
1121862276 14:97329591-97329613 ACATTTCAACATATGAATTCTGG + Intergenic
1121886566 14:97548378-97548400 AAATTTCAACATATGAATTTTGG + Intergenic
1121941803 14:98077855-98077877 AGATTTCAACATATGAATTTTGG + Intergenic
1121946114 14:98124130-98124152 GAATTTCAACATATGAATTTTGG - Intergenic
1122361715 14:101171213-101171235 AAATTTCAACCTATGAATTTTGG + Intergenic
1123136996 14:106037337-106037359 AAATTTCTAAAAATGTCGTAGGG - Intergenic
1123156268 14:106229396-106229418 GAATTCCAACAAATGTCTGAGGG + Intergenic
1202941602 14_KI270725v1_random:153409-153431 TAATTTCAAAAAATGAAATATGG + Intergenic
1123792657 15:23737914-23737936 AATTTTGAACAAATGTGTCATGG + Intergenic
1124062151 15:26303519-26303541 GAATTTCAACATATGAATTTGGG + Intergenic
1124336699 15:28862525-28862547 AAATTTAACCAATGGTATTATGG - Intergenic
1124352574 15:28968657-28968679 AGACTTCAACAAATGAATTTTGG - Intronic
1124379547 15:29153587-29153609 GAATTTCAACATATGAATTTTGG + Intronic
1124465893 15:29939644-29939666 GGATTTCAACAAATGAATTTTGG - Intronic
1124613933 15:31228304-31228326 AAATTTCTACATATGAATTTGGG - Intergenic
1124804241 15:32865171-32865193 AAATTTCAAAAAATTGATTGTGG + Intronic
1125119449 15:36136527-36136549 AAACTTCAACAAATAAATTTTGG + Intergenic
1125326840 15:38544407-38544429 AAATTTCAACAAATTTTGGAGGG - Intronic
1125397569 15:39266400-39266422 ATATTTCAACAAATGTATGTGGG - Intergenic
1125455010 15:39848574-39848596 CAATTTTTAAAAATGTATTAGGG - Intronic
1126233179 15:46351628-46351650 AAATTTTAACAAAAGAATAATGG - Intergenic
1126541425 15:49828630-49828652 GAATTTCAACATATGAATTTTGG + Intergenic
1126553850 15:49964801-49964823 ACATTTCAACAAATGAATCCTGG + Intronic
1127040566 15:54971203-54971225 AAATGCCAACAAATGTATAGGGG + Intergenic
1127564096 15:60169554-60169576 AAGTTTCAACATATGAATTTTGG + Intergenic
1127690453 15:61390879-61390901 TAATTTCCATATATGTATTATGG + Intergenic
1128704910 15:69831879-69831901 AGGTTTCAACATATGTATTTTGG + Intergenic
1128795116 15:70461071-70461093 AAATTACCACAAATGCATCAGGG + Intergenic
1129580491 15:76803803-76803825 AAATTTCAACATATGAATTTTGG + Intronic
1129620710 15:77142765-77142787 AAATTTCCAGAAATATATAAAGG + Intronic
1129827545 15:78644273-78644295 AAATTTTAACAAATGTGTTTTGG - Intronic
1129950155 15:79579293-79579315 AAATTTCAATGAAATTATTATGG - Intergenic
1130705319 15:86227682-86227704 AAATATCAATAAAGGTATTTTGG - Intronic
1131302713 15:91213593-91213615 AAATTTTTACAGATGAATTATGG - Intronic
1131321403 15:91395688-91395710 AATTCTCAACAAATTAATTATGG - Intergenic
1131650894 15:94398418-94398440 CAGTTTTAACAAATGTATTATGG - Intronic
1131752816 15:95527680-95527702 AAGTTTCAACACATGAATTCAGG + Intergenic
1132283277 15:100639310-100639332 AAATTTAAACAAAAATATTTCGG - Intronic
1132356652 15:101175928-101175950 AAATGAAAACAAATTTATTAAGG + Exonic
1133614524 16:7463607-7463629 AGATTTCACCATATGAATTAGGG + Intronic
1133813457 16:9178698-9178720 CAATTTCAACATATGAATTCTGG + Intergenic
1133843189 16:9428832-9428854 AAATTTGAACAAATGCACCAAGG + Intergenic
1134307367 16:13045143-13045165 AAAGTTTAAGAAATGTATTTAGG + Intronic
1134415092 16:14036483-14036505 ATATTTCAACATATATATGATGG - Intergenic
1134415093 16:14036513-14036535 TAATTTCAACATATATATGATGG - Intergenic
1134415095 16:14036572-14036594 ATATTTCAACATATATATGATGG - Intergenic
1134415096 16:14036602-14036624 ATATTTCAACATATATATGATGG - Intergenic
1134415097 16:14036632-14036654 ATATTTCAACATATATATGATGG - Intergenic
1134755261 16:16661420-16661442 AAATTTAAAAAATTATATTATGG + Intergenic
1134990804 16:18697751-18697773 AAATTTAAAAAATTATATTATGG - Intergenic
1135266221 16:21028197-21028219 AAATTTTAAAAAATATATTATGG - Intronic
1135568139 16:23527905-23527927 AAATTTCAACATATGAATTTAGG - Intronic
1135835096 16:25818177-25818199 AAATTTCAACATATGGATTTTGG - Intronic
1136007132 16:27338574-27338596 AAGTTTCAACATATGAATTTGGG - Intronic
1137041825 16:35620282-35620304 AAATTTCAAGAAAGGATTTAAGG - Intergenic
1137595181 16:49718871-49718893 AGATTTCAACAAACGAATTTGGG + Intronic
1137815919 16:51397420-51397442 AAAGTCCTACAAAAGTATTAAGG - Intergenic
1137909431 16:52361365-52361387 GAATTTCAACATATGAATTTGGG - Intergenic
1138311816 16:56031229-56031251 GAATTTCAACAAATGAAAAACGG + Intergenic
1138388104 16:56650249-56650271 AGATTTCAACAAATGAATATTGG - Intronic
1138693279 16:58788604-58788626 AAATTCCAACATATGAATTTTGG + Intergenic
1138898104 16:61234175-61234197 AAATTTCAGGGAATGTATTCAGG + Intergenic
1139029195 16:62858957-62858979 ACAATTCAACAAATTTATTGGGG - Intergenic
1139156530 16:64449768-64449790 TACTTTCAACAACTGTTTTATGG + Intergenic
1139177588 16:64708388-64708410 AAGTTTCAACAAATGAATCCAGG - Intergenic
1139363143 16:66415909-66415931 AAGTTCCAACAAATGAATTTGGG + Intergenic
1139413483 16:66786156-66786178 AAATTAATACAAATGTGTTAAGG + Intronic
1139763830 16:69210209-69210231 AAATGTAAAAAAATGTATTACGG + Intronic
1139946021 16:70642712-70642734 CAACTTCAACACATGTATTTTGG + Intronic
1140008039 16:71099263-71099285 AGATTTCAACATATGAATTTGGG - Intronic
1140155051 16:72415960-72415982 AAATTTGAATAAATAAATTAAGG - Intergenic
1140451538 16:75074923-75074945 AATATTGAATAAATGTATTAAGG + Intronic
1140555832 16:75920066-75920088 AAATTTCAACCAATTGAGTAAGG + Intergenic
1140573804 16:76139433-76139455 AATTTTCAACATATGAATTTTGG + Intergenic
1140595894 16:76410774-76410796 AAATTTTACCAAATGTTTTTAGG - Intronic
1141095746 16:81161701-81161723 AATTTTGAAAAAATGTATTTAGG + Intergenic
1143049064 17:4107685-4107707 TAAGTACAAAAAATGTATTAAGG + Intronic
1143206568 17:5144547-5144569 CCATTTCAACAAATGTATTTTGG - Intronic
1143690160 17:8555495-8555517 TCATTTCAACAAATGTGTCAAGG + Intronic
1144064765 17:11614908-11614930 AAATTTCAACACCTGAATTTTGG + Intronic
1144079642 17:11752054-11752076 AAATCTGTAAAAATGTATTAGGG + Intronic
1144384111 17:14732904-14732926 AAATTTGAAGAAAAGTATGAGGG + Intergenic
1145197915 17:20911565-20911587 AATTTTAAACAAAAGTAGTAAGG + Intergenic
1145825775 17:27876228-27876250 AAATTTCAAAACTTGAATTAAGG - Intronic
1145874417 17:28306406-28306428 AAATTTATAAAAACGTATTAGGG + Intergenic
1146755106 17:35423729-35423751 TAATTTCAACATATGAATTTTGG - Intronic
1146763910 17:35501667-35501689 AAATTTCAAGAAAAGATTTAAGG + Intronic
1149025447 17:52022090-52022112 TGATTTCATCAAATGAATTAGGG - Intronic
1149188101 17:54026058-54026080 AAATGTCAACAAATCGGTTATGG + Intergenic
1149767738 17:59293885-59293907 AAATTTCAACAAAAATACTTTGG - Intergenic
1149873830 17:60209664-60209686 CTATTTCAACAAATATATTTTGG + Intronic
1150087610 17:62286924-62286946 CTATTTCAACAAATATATTTTGG + Intergenic
1150180151 17:63110759-63110781 AAATTTCAACACCTGAATTTTGG + Intronic
1150583955 17:66500715-66500737 AATTTTCAACAAATGCACCAAGG - Intronic
1150892696 17:69172262-69172284 AAATTTAAACATATATATTTTGG - Intronic
1150907946 17:69358728-69358750 AAGTTTCAACACATGAATTTGGG - Intergenic
1151184786 17:72355777-72355799 GAATTTCAACATATGAATTATGG + Intergenic
1151485640 17:74397670-74397692 AAGTTTCAACATATGAATTTAGG - Intergenic
1151512906 17:74572341-74572363 AAGTTTCAACACATGAATTCTGG + Intergenic
1153275912 18:3367670-3367692 AGATTTCAACATATGAATTTTGG + Intergenic
1153469724 18:5430384-5430406 CTATTTCAACAAATGTGTAATGG - Intronic
1153830146 18:8914703-8914725 AAATTTCAAGAAAGGATTTAAGG + Intergenic
1154014295 18:10603118-10603140 AAATTTCAAAAAAGGATTTAAGG - Intergenic
1154053543 18:10988022-10988044 AAGTTTCAACATATGAATTTTGG - Intronic
1154935412 18:21050987-21051009 AGAATTCAAAAAATGTAATAAGG + Intronic
1155388206 18:25304181-25304203 ACATTTTAACAAAAGCATTAAGG + Intronic
1155727884 18:29112373-29112395 GAATTTCAACACATGAATTTGGG + Intergenic
1155806039 18:30173116-30173138 AGCTTTCAACATATGAATTAGGG + Intergenic
1155937130 18:31765599-31765621 AGACTTCAACATATGAATTAAGG + Intergenic
1156050472 18:32927552-32927574 GAATTTTAACAAATGTGTTAAGG + Intergenic
1156050928 18:32933238-32933260 AAATTTCAACATAAGGTTTAAGG - Intergenic
1156145901 18:34177441-34177463 AAGTTTTAACAAATTTATTTAGG - Intronic
1156258198 18:35419474-35419496 AAATTTCAACATCTGAATTTTGG - Intergenic
1156702289 18:39840402-39840424 AACTTTCAGCAAATGTACAAGGG - Intergenic
1157082677 18:44543783-44543805 AAAAACCAACAAATGGATTAAGG - Intergenic
1158028344 18:52930713-52930735 ATGTTTCAATAAATGTATGAAGG - Intronic
1158142816 18:54273837-54273859 CAATTTAGACAAATGTAATACGG + Intronic
1158299541 18:56035809-56035831 AGATTTCAACATATGAATTTAGG + Intergenic
1158331028 18:56362012-56362034 AGATTTCAACCAATGCAATAAGG + Intergenic
1158400376 18:57116345-57116367 AAGTTTCAACAGATGGATTTGGG + Intergenic
1158429811 18:57375303-57375325 AGATTTCAACATATGCATTGGGG - Intergenic
1158687249 18:59625759-59625781 AAGTTTCAACACATGAATTTTGG - Intronic
1158880496 18:61774769-61774791 CAATTTCTAGAAATGAATTATGG + Intergenic
1158899069 18:61945024-61945046 CAATTTGAACCAATGTATTGAGG - Intergenic
1159104345 18:63988467-63988489 GAATTTTAAAAAATATATTAAGG - Exonic
1159153345 18:64549673-64549695 AAATTTCAACAAATTCAAAAAGG - Intergenic
1159164049 18:64680881-64680903 AAGTTTTGACAAATGTATAATGG + Intergenic
1159600592 18:70425208-70425230 ACATTTTAACAACTGTATCAGGG + Intergenic
1159670371 18:71214182-71214204 AAATTTATAAAAATGTATGAAGG - Intergenic
1159847938 18:73488914-73488936 AAAAATCTACAAATGTGTTACGG + Intergenic
1160071845 18:75635852-75635874 TAATTTCAACACCTGAATTATGG + Intergenic
1163868407 19:19795828-19795850 AATTTTTTACAAATGTATTTTGG - Intronic
1163911359 19:20196774-20196796 AATTTTTTACAAATGTATTTTGG + Intronic
1163922346 19:20302715-20302737 AATTTTTTACAAATGTATTTTGG + Intergenic
1163946917 19:20546144-20546166 AATTTTTTACAAATGTATTTTGG - Intronic
1163971848 19:20805637-20805659 AATTTTTTACAAATGTATTTTGG + Intronic
1163984197 19:20929549-20929571 AAATTTAAAGAAATATTTTAAGG - Intronic
1163985732 19:20948553-20948575 AATTTTCCACAAATGTATTTTGG + Intronic
1164020118 19:21294896-21294918 AATTTTTTACAAATGTATTTTGG - Intronic
1164021840 19:21314335-21314357 CAATTTAAACAAATCTCTTAAGG + Intronic
1164141520 19:22470771-22470793 AATTTTCCACAAAAGTATTTTGG + Intronic
1164174598 19:22759850-22759872 AATTTTCAACAAATATATTTTGG - Intronic
1164183802 19:22843810-22843832 CAATTTAAATAAATGTCTTAAGG - Intergenic
1164184907 19:22856933-22856955 CATTTTCCACAAATGTATTTTGG + Intergenic
1164223854 19:23224505-23224527 AATTTTTCACAAATGTATTTTGG - Intronic
1164252537 19:23493858-23493880 AATTTTCCACAGATGTATTTTGG - Intergenic
1164278422 19:23745802-23745824 AATTTTCCACAAATGTATTTTGG - Intronic
1164319261 19:24126063-24126085 AATTTTCCACAGATGTATTTTGG + Intronic
1164681660 19:30138117-30138139 AAAAATCAACAAAAATATTAAGG + Intergenic
1165657536 19:37547632-37547654 AAATTTAAACAAATGTTTTATGG - Intronic
1166260496 19:41637156-41637178 ACTTTTCAAAAAATGTATTATGG - Intronic
1166796991 19:45432540-45432562 AAAATTTAAAAAATGTATTGAGG - Intronic
1168449835 19:56457785-56457807 AAATTTCAACATAGGCATTTGGG - Intronic
1168727499 19:58595390-58595412 ATATTTCGACAAATGCATTGTGG + Intergenic
925214107 2:2078878-2078900 GAATTTCAACATATGAATTTGGG - Intronic
925575578 2:5356784-5356806 AAGTTTCAACACATGAATTTGGG + Intergenic
925645202 2:6029044-6029066 GAATTTCAACATATGTGTTTTGG - Intergenic
925696439 2:6584918-6584940 AAATTTCAACATGAGTTTTAGGG + Intergenic
925699595 2:6622130-6622152 AAATTTCAACAAGGGAATTTTGG - Intergenic
925710242 2:6731968-6731990 AAGTTTCAACATATGAATTTGGG - Intergenic
925961140 2:9017727-9017749 AAATTTCGTCAAATGAAATAAGG + Intergenic
926041725 2:9679081-9679103 AGATTTCAACATATGAATTTTGG - Intergenic
926257906 2:11225346-11225368 AAACTTCAAAAAATGTCTTCAGG + Intronic
926291210 2:11532056-11532078 TAATTTCAACATATTTAATATGG - Intergenic
926427575 2:12753387-12753409 AGATTTCAACATATGCATTTTGG - Intergenic
926458018 2:13092700-13092722 ACATTTCAACATATGAATTTTGG + Intergenic
926467039 2:13204441-13204463 AAAATTCAACAAAAGTTATATGG - Intergenic
926660095 2:15455388-15455410 TAATTTCAACAAATATGCTATGG + Intronic
926912666 2:17865698-17865720 AAGTTTCAACACATGAATTTTGG + Intergenic
926929827 2:18025875-18025897 TAATTTCGAGAAATGTACTATGG - Intronic
927160364 2:20252790-20252812 AATGTTCAACCCATGTATTATGG + Intronic
927265889 2:21150254-21150276 AAATTAACACAAATGTTTTAGGG - Intergenic
927449571 2:23195874-23195896 AAAATTTTAAAAATGTATTATGG + Intergenic
928248311 2:29651464-29651486 AAATTATAACCAATGCATTAAGG - Intronic
928447161 2:31342817-31342839 AAAGTTCAACAAATGATTTGAGG + Intronic
928580624 2:32704125-32704147 AAGTTTCAACATATATATTTTGG + Intronic
928680508 2:33697474-33697496 ATATGTCAACAAATGCATAATGG + Intergenic
928738400 2:34320424-34320446 AAATTTAAAAAAATTTATAAAGG + Intergenic
928743814 2:34388326-34388348 AAAATTCAATTAATGTATTTGGG - Intergenic
928773742 2:34733408-34733430 TCATTTCAACAAATAAATTAAGG - Intergenic
929058690 2:37901228-37901250 GAATTTCAACAAATGAAGTTAGG + Intergenic
929170298 2:38925897-38925919 AAATTTCAACTTGTGTTTTATGG - Intronic
929275491 2:40020839-40020861 AAATTTCTACAAATCTCTAAGGG - Intergenic
929524269 2:42685701-42685723 AAAATACAACAAATCTAATATGG - Intronic
929815384 2:45226984-45227006 AAATTTCAAGAAATATGTGAAGG + Intergenic
929837817 2:45424065-45424087 TAATTTTAATAATTGTATTATGG - Intronic
930657138 2:54017563-54017585 AAGTTTCAACATATGAATTTTGG + Intronic
930786519 2:55276638-55276660 AAATGTCAATAAATATATTTTGG - Intergenic
931110268 2:59103004-59103026 AAATTTCAACATATGAATTTTGG - Intergenic
931333235 2:61310891-61310913 AAATTTCAAGAAGTTTTTTATGG + Intronic
931420082 2:62118987-62119009 GAATTTCAACATATGAATTTTGG - Intronic
931731597 2:65158356-65158378 AAATTTAAACAAGTGTCCTATGG - Intergenic
931833545 2:66076169-66076191 AAATACCAACATATGTATCAAGG + Intergenic
933016398 2:77132783-77132805 AAGTTTTAACACATGAATTATGG + Intronic
933092725 2:78141663-78141685 AAAATTCAAAAAGTTTATTAGGG - Intergenic
933100029 2:78243882-78243904 GGATTTCAACAAATGAATTTTGG - Intergenic
933139162 2:78772160-78772182 AAATTTTAATAACTGTATTTTGG - Intergenic
933152668 2:78933756-78933778 AACTTTAAACAAAGGTATAACGG - Intergenic
933168663 2:79100598-79100620 AGATTTCAAAAAATGTGTCAGGG - Intergenic
933299578 2:80526932-80526954 AAATTTCAAAAAATGTTAGAAGG - Intronic
933376362 2:81484536-81484558 GAATTTCAACACATGAATTTTGG - Intergenic
933878347 2:86643078-86643100 AAAAATAAATAAATGTATTATGG - Intronic
934126708 2:88900643-88900665 AGATTTCAACATATGAATTTTGG - Intergenic
934649288 2:96081283-96081305 ACATTTCAACATATGAATTTTGG - Intergenic
934891457 2:98074028-98074050 ATATTTCAACATATGAATTTTGG + Intergenic
935429541 2:102960311-102960333 AAGTTTCAACACATGGATTTTGG + Intergenic
935441561 2:103103992-103104014 AAATTTAAACCAGTGCATTATGG - Intergenic
935721677 2:105985272-105985294 AAATTTCAAGAAAGGATTTAAGG - Intergenic
935987010 2:108684204-108684226 ACATGTCAACAAATGGATAAGGG - Exonic
936854873 2:116945233-116945255 CAATTTCAACAAAAGTAGAATGG + Intergenic
937519471 2:122694138-122694160 GAATTACAACAAATTTGTTAAGG + Intergenic
937586997 2:123564922-123564944 AAATTGGAACAAATGCATTAAGG + Intergenic
937797299 2:126038901-126038923 CAGTTTCAACATATGTATTTTGG + Intergenic
938737787 2:134202215-134202237 AGATTTCAACATATGAATTTTGG - Intronic
938914165 2:135917901-135917923 AAATTTAAAAAAATCAATTATGG - Intronic
938974745 2:136465438-136465460 AAGTTTCAACACATGAATTTTGG + Intergenic
939108917 2:137983333-137983355 AAATTACAACAATGGTATAATGG - Intronic
939187750 2:138880500-138880522 AAATTACAGCCAACGTATTATGG + Intergenic
939291911 2:140206785-140206807 GGATTTCAACATATGAATTATGG + Intergenic
939355386 2:141094920-141094942 AACTTTCAACACATGTTTTTGGG - Intronic
939358012 2:141129087-141129109 AAATTTTAAAAAATGAAATAAGG + Intronic
939444743 2:142294014-142294036 AAATTTCAACATATGTCCTATGG - Intergenic
939703097 2:145419170-145419192 ATATTCCTACAAATGTATTCTGG - Intergenic
939877749 2:147597303-147597325 AAATTTCAACCTATGAATTTTGG - Intergenic
940069494 2:149669736-149669758 AAGTTTCAACATATGAATTTTGG - Intergenic
940130948 2:150381241-150381263 AAAATTAAAAAAAAGTATTAGGG - Intergenic
940163871 2:150746122-150746144 AAATTTTAATAGATGTATAATGG - Intergenic
940781998 2:157942692-157942714 AAGTTTCAACACATGAATTTTGG - Intronic
941221268 2:162784839-162784861 AAATTTCAGCAAATATTTAATGG + Intronic
941277885 2:163513687-163513709 AGATTTCAACATATGAATTTGGG + Intergenic
941310396 2:163921847-163921869 AGATTTCAACATATGAATTTGGG + Intergenic
941353895 2:164465639-164465661 AAGTTTCAACATATGAATTTTGG + Intergenic
941634410 2:167920277-167920299 AGATTTCAATACTTGTATTAAGG + Intergenic
941743681 2:169063783-169063805 AAATGTCAACACAAGTATTTTGG - Intergenic
942325006 2:174769116-174769138 AAATGCCAACAAGTGGATTAAGG + Intergenic
942489598 2:176476257-176476279 ATATTTCAACATATGAATTTTGG - Intergenic
942709278 2:178814499-178814521 GAATTTCAACATATGAATTTTGG - Intronic
943143174 2:184008684-184008706 AACTTTTATCAAATGTATTGTGG - Intergenic
943148633 2:184079871-184079893 AGATATCAACAAATGAATTTTGG + Intergenic
943269410 2:185779358-185779380 AAATTTAAACAAAAATGTTAGGG - Intronic
943407859 2:187511533-187511555 AAATTTCAAGAAAGGATTTAAGG + Intronic
943467157 2:188241938-188241960 GAATTTCCACAAATGAATTTGGG - Intergenic
943545041 2:189265615-189265637 AGACTTCAACAAATCTTTTATGG + Intergenic
943630777 2:190249527-190249549 AAATATAAATAAATGTACTAAGG - Intronic
943856310 2:192797277-192797299 TACTTTCTACAAATGTAGTAAGG + Intergenic
944214775 2:197243854-197243876 AAGTTTCAACATATGAATTTTGG + Intronic
944227433 2:197362001-197362023 AAATTTCAACATTTGAATTTTGG - Intergenic
944294680 2:198048859-198048881 AAGTTTCAACATATGAATTTTGG + Intronic
944342286 2:198616116-198616138 GCATTTCAACAATTTTATTATGG - Intergenic
944480080 2:200148103-200148125 ATATTTCCAGAAATGTCTTAAGG - Intergenic
944500903 2:200359119-200359141 AAACTTCAAGAAATCAATTAGGG + Intronic
944714484 2:202365281-202365303 AAATATGAACAAATGTATTCAGG + Intergenic
944767943 2:202883802-202883824 AAATTTCTACAAATATTTTTTGG - Intronic
945319489 2:208405714-208405736 GAACTTCAACATATGTATTTTGG - Intronic
945637811 2:212379112-212379134 AAATTTCAGCTAATGTTTGAAGG - Intronic
945843785 2:214918800-214918822 AAATTTCAACACATGAATTTTGG - Intergenic
945902742 2:215557040-215557062 AGACTTCAACATATGTATTTAGG - Intergenic
945956487 2:216091169-216091191 AAATTTCAACATATGGATTTGGG - Intronic
946318984 2:218937724-218937746 GGATTTCAACAAATGAATTTGGG - Intergenic
946376237 2:219310873-219310895 AAATTTAAAAAATTATATTAAGG - Intergenic
946476085 2:220007780-220007802 ACATTTCAACATATGAATTTTGG + Intergenic
946499412 2:220230273-220230295 AAATTCCAACACATGTTTTTTGG - Intergenic
946550416 2:220795211-220795233 AAGTTTTAACACATGTATTTTGG - Intergenic
946760748 2:222990728-222990750 AAGTTTCAACATATGAATTCTGG + Intergenic
946972214 2:225107010-225107032 AAAATTCAACCAATTTCTTATGG + Intergenic
946991774 2:225339294-225339316 AAATTTCAACCAATCTGTGAAGG - Intergenic
947121735 2:226822715-226822737 AAATTTCAACATATGAATTTTGG - Intergenic
947145046 2:227056679-227056701 AACTTTCAACATATGAATTTTGG - Intronic
947270841 2:228333115-228333137 AGATATCAACTAATCTATTATGG + Intergenic
947317002 2:228870949-228870971 AAACTTCAACATATGAATTTTGG - Intronic
947585057 2:231350337-231350359 AAATTAAAACAAAAATATTACGG + Intronic
947674728 2:231967815-231967837 AATTTTTAATAAATGAATTAGGG + Intronic
949087960 2:242173371-242173393 ATATTTCGACAAATGCATTGTGG + Intergenic
1168906016 20:1404453-1404475 AAATTTCAACATATGAATTTGGG + Intergenic
1169292146 20:4361906-4361928 GGATTTCAACATATGAATTAGGG - Intergenic
1169409939 20:5359774-5359796 AAGTTTCAACATATGAATTTTGG + Intergenic
1169596553 20:7206248-7206270 AAATTTCTAACAATGTATAATGG - Intergenic
1169687499 20:8291570-8291592 AAATATCAACAAATAAATCATGG - Intronic
1169877179 20:10310890-10310912 AAGTTTCAACACATGAATTTTGG + Intergenic
1170022938 20:11855692-11855714 AAATTATAACAAATGTGTAATGG + Intergenic
1170220018 20:13932136-13932158 ACATTACAACAAATTTATAATGG + Intronic
1170497971 20:16945218-16945240 ACATTGCAACATATTTATTAAGG + Intergenic
1170690357 20:18609544-18609566 AAATTTCAAAAATTTTATTAAGG - Intronic
1170765979 20:19290352-19290374 GAATTTCAACAAATGAATACTGG - Intronic
1170970640 20:21113072-21113094 CAATTTCAACATATGAATTTTGG + Intergenic
1171054583 20:21893975-21893997 TGATTTCAACAAATGAATTTTGG - Intergenic
1171394825 20:24825252-24825274 AAGTTTCAACATATGAATTTTGG + Intergenic
1171775761 20:29365936-29365958 AAATTTCAACAAATTAAGTTGGG + Intergenic
1172219924 20:33266809-33266831 AAGTTTCAACACATGAATTTTGG - Intergenic
1172804441 20:37601335-37601357 AAATTTCAACATGAGTTTTAAGG - Intergenic
1172826591 20:37793519-37793541 CAAATTCAACAAATGAATTTTGG - Intronic
1173017802 20:39242252-39242274 AAATTTAAAAAAATGGATCATGG + Intergenic
1173321662 20:41992703-41992725 AAGTTTCAACATATGAATTTTGG + Intergenic
1173900354 20:46583182-46583204 AAATTTCCACAAATTCCTTAGGG + Intronic
1174431962 20:50476783-50476805 CAATTTCAAAACATGTACTATGG - Intergenic
1174623478 20:51894957-51894979 AAGTTTCAACACATGAATTTTGG - Intergenic
1174734951 20:52956973-52956995 ACATTTTAAAAAATGTATTCAGG + Intergenic
1174856719 20:54052491-54052513 AAGTTTCAACATATGAATTTTGG - Intronic
1175662940 20:60832674-60832696 AAAATTCAACAAATGCAATTGGG + Intergenic
1175702557 20:61150759-61150781 AAGTTTCAACACATGAATTTTGG + Intergenic
1176581563 21:8533525-8533547 TAATTTCAAAAAATGAAATATGG - Intergenic
1176942514 21:14941116-14941138 GAATTTCAACAAATATTTAAAGG - Intergenic
1177019480 21:15836460-15836482 AAATCTCAACAAAAGTATTCAGG - Intronic
1177019489 21:15836542-15836564 AAATCTCAACAACAGTATTCAGG - Intronic
1177019498 21:15836624-15836646 AAATCTCAACAACAGTATTCAGG - Intronic
1177019507 21:15836706-15836728 AAATCTCAACAACAGTATTCAGG - Intronic
1177019514 21:15836788-15836810 AAATCTCAACAACAGTATTCAGG - Intronic
1177019522 21:15836870-15836892 AAATCTCAACAACAGTATTCAGG - Intronic
1177019531 21:15836952-15836974 AAATCTCAACAACAGTATTCAGG - Intronic
1177019539 21:15837034-15837056 AAATCTCAACAACAGTATTCAGG - Intronic
1177019555 21:15837198-15837220 AAATCTCAACAACAGTATTCAGG - Intronic
1177019563 21:15837280-15837302 AAATCTCAACAACAGTATTCAGG - Intronic
1177019571 21:15837362-15837384 AAATCTCAACAACAGTATTCAGG - Intronic
1177149222 21:17437905-17437927 AAATTTCAAGAAATAAATCAAGG + Intergenic
1177448563 21:21233621-21233643 AAATTTCAAAACTTGTTTTAAGG + Intronic
1177502650 21:21978054-21978076 AGATTTCAACATATGAATTTTGG + Intergenic
1177531662 21:22366992-22367014 ACCTTTCACCAAATATATTAAGG + Intergenic
1177539546 21:22473719-22473741 TCATTTCAACAAATATATTTTGG - Intergenic
1177637980 21:23810182-23810204 CCATTTCAACTAATGTGTTAGGG - Intergenic
1177749012 21:25256754-25256776 AGGTTTCAACAAATGAATTTGGG + Intergenic
1177979270 21:27890236-27890258 ACATTTCAACAAATATTTAAGGG + Intergenic
1178165014 21:29963967-29963989 ATGTTTCAACAAATGAATTTGGG - Intergenic
1178166188 21:29980417-29980439 AAGTTTCAACACCTGTATTTTGG - Intergenic
1178326728 21:31652352-31652374 AAACTTTAACATATGTATTTGGG + Intergenic
1178352687 21:31884156-31884178 GAATTTCAACAAAAGAATTTTGG - Intronic
1178995219 21:37393077-37393099 AGTTTTCAACAAATGAATTTTGG + Intronic
1179344574 21:40544982-40545004 TAATTTCGACAAATGAATTTTGG - Intronic
1180262939 21:46687192-46687214 ATATTTCGACAAATGCATTGTGG + Intergenic
1180264398 22:10510597-10510619 TAATTTCAAAAAATGAAATATGG - Intergenic
1180599521 22:17007218-17007240 AAATTTCAACAATTTTACTGAGG - Intronic
1180928600 22:19573664-19573686 AAGTTTCAACACATGAATTTTGG + Intergenic
1181385264 22:22540456-22540478 GAATTACAACAAATGAATTTTGG + Intergenic
1181839581 22:25645127-25645149 AGATTTCACCAAATTTCTTATGG - Intronic
1182915270 22:34023659-34023681 AAATTCCAGCAAATGAATTTTGG - Intergenic
1183004672 22:34891168-34891190 GAATTTCAACAAATGAATTTTGG + Intergenic
1183007537 22:34916064-34916086 AGATTTCAACATATGAATTCGGG - Intergenic
1184680021 22:46066504-46066526 AAATCTGAAAATATGTATTAAGG - Intronic
1185201771 22:49511351-49511373 GGATTTCAACAAATGAATTTTGG - Intronic
1185429141 22:50795066-50795088 ATATTTCGACAAATGCATTGTGG + Intergenic
949372997 3:3355207-3355229 AAGTTTCAACATATGGATTTTGG - Intergenic
949411761 3:3773294-3773316 GGATTTCAACACATGTTTTAGGG + Intronic
949487754 3:4556368-4556390 AGATTTGGACAAATGTATAATGG + Intronic
949598863 3:5577391-5577413 GAATTTCAACGAATGAATTTTGG - Intergenic
949681470 3:6519382-6519404 GAATTTCAACATATGAATTTTGG + Intergenic
949700299 3:6748955-6748977 AAATCTAAAAAAATGTAATAGGG - Intergenic
949784965 3:7730571-7730593 AAAGTTCAATAAATGTATAAAGG + Intronic
949843682 3:8349531-8349553 GAATTTCAACATATGAATTTTGG - Intergenic
949908244 3:8877476-8877498 AAGTTTCAACACATGAATTTTGG + Exonic
950798871 3:15533245-15533267 AAGTTTCAACATATGAATTTGGG + Intergenic
950920228 3:16686553-16686575 AATGTGCAAGAAATGTATTAAGG + Intergenic
951367202 3:21797933-21797955 ATATTTAGACAAATGTATAATGG - Intronic
951424188 3:22523733-22523755 TAATTTTAAAAAATGTATTGTGG + Intergenic
951690449 3:25390081-25390103 AAGTTTCAACATATGAATTTTGG - Intronic
951942173 3:28091701-28091723 AAGTTTCAACATATGAATTTTGG - Intergenic
952236808 3:31488441-31488463 AAGTTTCAACATATGAATTGGGG - Intergenic
952648696 3:35695687-35695709 AGACTTAAACAAATGTAGTAAGG + Intronic
952686816 3:36159532-36159554 GAATTTCAACATATGAATTTGGG + Intergenic
952728434 3:36614061-36614083 ATATTTCTAGAAATGTCTTAAGG - Intergenic
953117298 3:40005878-40005900 AAATTGCAAAAAGTCTATTAAGG + Intronic
953670787 3:44960136-44960158 AAATTTGAACATATCTATTGAGG - Intronic
955050542 3:55406467-55406489 AGCTTTCAACAAATGAATTTTGG - Intergenic
955100158 3:55841123-55841145 AAGTTTTAACAAATTTATTTAGG - Intronic
955105383 3:55892899-55892921 AGATTTCAACATATGAATTGTGG - Intronic
955127051 3:56123181-56123203 ATATTTCAACATATGAATTTTGG - Intronic
955437334 3:58915707-58915729 ACATTTTAAAAATTGTATTATGG + Intronic
955930931 3:64056050-64056072 AGATTTCAACATATGAATTTTGG - Intergenic
955965294 3:64382871-64382893 AAGTTTCAACATATGAATTGGGG - Intronic
956534551 3:70261163-70261185 AAATTTCAAGCAATGCATAAGGG - Intergenic
956979644 3:74620938-74620960 AGATTTCAACATATGGATTTTGG + Intergenic
957023860 3:75156750-75156772 AGATTATAGCAAATGTATTAAGG + Intergenic
957340762 3:78893178-78893200 AAATTTCAGCACCTGTATTTTGG - Intronic
957385660 3:79492576-79492598 ATATATAAATAAATGTATTATGG + Intronic
957538820 3:81541468-81541490 ATATTTCAACATATGAATTTGGG - Intronic
957740387 3:84260053-84260075 AAATTTCAACATATAAATTTGGG - Intergenic
957868455 3:86055736-86055758 AGATTTCAACACATGAATTTTGG + Intronic
957894343 3:86401994-86402016 AAATTTCAATCAATGGATTCTGG + Intergenic
957936568 3:86951494-86951516 AGATTTCAACATATGAATTTGGG + Intronic
958061762 3:88492603-88492625 AGATTTCAACATATATTTTACGG + Intergenic
958415180 3:93865434-93865456 ATATTTCAACATATGAATTCTGG + Intergenic
958560574 3:95743359-95743381 AAATTTGAACTAATGTTTAAAGG - Intergenic
958868264 3:99526384-99526406 GAATTTCAACATATGAATTCAGG + Intergenic
958984545 3:100765131-100765153 ACATTTCTAGAAATGTAGTAAGG - Intronic
959164308 3:102758284-102758306 AAGTTTCAACATATGAATTTGGG - Intergenic
959193258 3:103142637-103142659 AAGTTTCAACATATGAATTTTGG - Intergenic
959328796 3:104975410-104975432 AGACTTCAAAAAATGTATTAGGG - Intergenic
959373643 3:105560798-105560820 AAGTTTTGACAAATGTGTTACGG - Intronic
959770142 3:110084945-110084967 AAATTTCAACAGAAATATTTTGG + Intergenic
959770873 3:110094169-110094191 AGGTTTGAACAAATGTATAATGG + Intergenic
959777438 3:110184344-110184366 GAATTTCAAAAAATATATTTAGG - Intergenic
960288471 3:115856205-115856227 AAGTTTCAACATATGAATTTTGG - Intronic
960348674 3:116566947-116566969 TAATTTCAACAAACATATTTGGG + Intronic
960406271 3:117264014-117264036 ATTTTTCTACAAATGCATTATGG - Intergenic
960574064 3:119212209-119212231 AAATTTGAAGTAATATATTATGG - Exonic
960617155 3:119606452-119606474 AGATTTCAACATATGAATTTTGG + Intronic
960813813 3:121652863-121652885 TCATTTCAACAAAAGAATTACGG + Intronic
960819256 3:121710536-121710558 TTTTTTCAACAAATGTATTGGGG + Intronic
961089278 3:124095645-124095667 ATATTTGATAAAATGTATTAAGG - Intronic
961231283 3:125313211-125313233 AAATTTCAGAAAATGTTTCAGGG - Intronic
961436082 3:126917662-126917684 AGATTTCAACATATGTGTTCTGG - Intronic
961582541 3:127894296-127894318 AAATTTCACCAAAAATATTAGGG - Intergenic
961695831 3:128703869-128703891 AAGTTTCAACACTTGAATTATGG - Intergenic
962096942 3:132302360-132302382 AAATTTCAAGAAAGGATTTAAGG - Intergenic
962150902 3:132892396-132892418 TAATTTCAACATATGAATTTAGG + Intergenic
962303229 3:134262075-134262097 GAGCTTCAACAAATGAATTATGG + Intergenic
962597533 3:136961735-136961757 TAGTTTTGACAAATGTATTATGG + Intronic
962842105 3:139243417-139243439 AAATTTCAACATAAGAATTTTGG + Intronic
963346867 3:144105432-144105454 AAACTTCAACAAAAGCAATATGG + Intergenic
963512713 3:146268940-146268962 GAATTTCAACATATGAATTTGGG - Intergenic
963617708 3:147563541-147563563 AAATTTCAACATAGGGATTTTGG - Intergenic
963982024 3:151548910-151548932 AATTTTCAACACTTTTATTAAGG + Intergenic
964011202 3:151894157-151894179 AAATTTCACCCAATGTATTGAGG + Intergenic
964198913 3:154095638-154095660 ACATTTCACAACATGTATTAAGG + Intergenic
964395286 3:156239076-156239098 AAAATTCTTCAAATTTATTATGG - Intronic
964844403 3:161030151-161030173 AAGTTTCAACATATGAATTCAGG - Intronic
964881852 3:161431745-161431767 AAGTTTCAACACATGAATTTTGG + Intergenic
964998304 3:162917168-162917190 AAATTTTAACAAATATTTTCTGG + Intergenic
965201184 3:165659532-165659554 AACTTTCAACATATGAATTTTGG + Intergenic
965566638 3:170126419-170126441 AAACTTCCAAAAATGTTTTAAGG + Intronic
965646388 3:170886103-170886125 AAATAACAAAAAATATATTAAGG - Intergenic
965817015 3:172647419-172647441 AAATGTTAACATGTGTATTAAGG + Intronic
965835542 3:172847800-172847822 AAGTTTCAACATATGAATTTTGG - Intergenic
965840069 3:172894650-172894672 GAATTTCAACATATGAATTTGGG - Intronic
965946807 3:174252654-174252676 GAATTCCAACAAAAATATTAGGG - Intronic
965957314 3:174386685-174386707 AAATTTCAACCTATGAATTTTGG + Intergenic
966226674 3:177605379-177605401 AAGTTTCAACATATGAATTTTGG - Intergenic
966367837 3:179209826-179209848 AAATTTTAATAAATGTATCATGG + Intronic
966458496 3:180145896-180145918 AAATTTTAACAAATTTCTAAAGG + Intergenic
966480748 3:180405649-180405671 TAATTTCAACATATGAATTTGGG + Intergenic
966515333 3:180814583-180814605 AAATTTCTTCAAATGTATTATGG + Intronic
966526711 3:180927426-180927448 AAATCTGAACAGATGTATTATGG - Intronic
966551450 3:181208891-181208913 AGATTTCAACATATGAATTTTGG + Intergenic
967129014 3:186453480-186453502 AAATTTCAACACATGAATTGGGG - Intergenic
967302641 3:188030800-188030822 AAATATAAATAAATGTATTGAGG - Intergenic
967384280 3:188895818-188895840 AAATTTCACCAAATCTTTTCAGG + Intergenic
967531911 3:190557736-190557758 AAAACTCAACAAATGATTTATGG - Intronic
967911460 3:194545791-194545813 GAATTTCAACATATGAATTTTGG + Intergenic
968167913 3:196483171-196483193 AAATTTCAACAAATCTTGGAAGG + Intronic
968344549 3:197990371-197990393 AAATTTAAAAAAATGTAGAAAGG + Intronic
969421231 4:7097611-7097633 GAATTTCAACACATGAATTTTGG - Intergenic
970689450 4:18605745-18605767 AAATGTCAAAACATGTAGTATGG - Intergenic
970822128 4:20230111-20230133 ATAATTCAAAAAATGTAGTAAGG - Intergenic
970832495 4:20358519-20358541 AATTTTCAAGAAAAATATTAAGG + Intronic
971032889 4:22660127-22660149 CAATTTCAACATATGAATTTGGG + Intergenic
971075590 4:23145228-23145250 ATATTTCAACATATGAATTTGGG - Intergenic
971103774 4:23498859-23498881 GGATTTCAACATATGTATTTGGG + Intergenic
971422580 4:26487598-26487620 AAAATCCAACAAAATTATTATGG + Intronic
971566758 4:28153709-28153731 AAATTTTACCAAATGTATTTAGG + Intergenic
971597649 4:28552203-28552225 AAGTTTCAACATATGAATTTTGG - Intergenic
971670612 4:29551397-29551419 AAAATTCAACACATAAATTAGGG - Intergenic
971735990 4:30452804-30452826 AAATTTCAAGAATTGTCTTGAGG - Intergenic
971910328 4:32788215-32788237 GGATTTCAACAAATGAATTTGGG - Intergenic
971989556 4:33873835-33873857 AAATTTCAGCAGATGTCCTAGGG + Intergenic
972102409 4:35438140-35438162 AGATTCCAACAAATGTATTTTGG + Intergenic
972181354 4:36470666-36470688 AAGTTTTAACAAATGAATTTAGG - Intergenic
972219980 4:36943804-36943826 AAATTACTATAAATATATTAAGG + Intergenic
972274865 4:37547476-37547498 AAATTTCAAGAAAGGATTTAAGG + Intronic
972769697 4:42185792-42185814 AGACTTCAACAAATGAATTTTGG - Intergenic
972834582 4:42854448-42854470 AAATTTGAGCAGATGAATTAAGG + Intergenic
972988621 4:44797030-44797052 GGCTATCAACAAATGTATTATGG - Intergenic
973000607 4:44944401-44944423 AAATTTCAACATCTGAATTTTGG + Intergenic
973073333 4:45893366-45893388 AAGTTTCAACATATGAATTTTGG + Intergenic
973152077 4:46900614-46900636 GAATGTCAACAAATGAATTTTGG - Intronic
973610406 4:52631022-52631044 TATTTTCATCAAATGTTTTAGGG - Intronic
973713122 4:53649147-53649169 AAATTTAAACAAATAGATTTTGG - Intronic
973783377 4:54312057-54312079 AAATATCAATTAATGAATTATGG - Intergenic
973986325 4:56357447-56357469 AGATTTCAACATATGAATTCTGG + Intronic
974225424 4:59036758-59036780 AAATGTGAACTAATATATTAAGG + Intergenic
974357350 4:60830311-60830333 AAATGTCAACAATAGGATTATGG - Intergenic
974441840 4:61929089-61929111 AAGTTTCAACACATGAATTATGG - Intronic
974465054 4:62244494-62244516 AAGTTTCAACATATGAATTTTGG + Intergenic
974474176 4:62358657-62358679 AAATTACAACATATTTATTAAGG - Intergenic
974589505 4:63925612-63925634 GAATTTCGACATATGTATTTGGG + Intergenic
974821759 4:67075661-67075683 AAATTTCAACATATGAATTTTGG - Intergenic
974931090 4:68361760-68361782 GAATTTCAACAAACGGATTTTGG + Intergenic
975351353 4:73350828-73350850 ACATTTCAACAAAAGTTTTGGGG + Intergenic
975510319 4:75187657-75187679 AAATTTCAATAATTTTTTTAGGG - Intergenic
976050108 4:81001608-81001630 AAGTTTCAACATATGAATTTTGG + Intergenic
976081318 4:81358236-81358258 AAATATCAACAGACGTATTCAGG - Intergenic
976427555 4:84923391-84923413 AACTTGCAAAAAATGTAATAAGG - Intronic
976668761 4:87628641-87628663 AAATTTCAACAAATGAATGGGGG - Intergenic
976917442 4:90394628-90394650 AAATTTAAACAAATATATAAAGG - Intronic
976982508 4:91248243-91248265 AAATTGCAACTAATTTATTTAGG + Intronic
977043819 4:92045140-92045162 AAATTTCAAGAAATAATTTAAGG - Intergenic
977086859 4:92610667-92610689 AAAGTTCTACAAATGGATTTTGG - Intronic
977118978 4:93072801-93072823 AAATTTACACAAATCTATTATGG + Intronic
977437848 4:97022741-97022763 AGATTTCAACATATGAATTTTGG - Intergenic
977458220 4:97290858-97290880 AAATTTTAAAAAACTTATTATGG - Intronic
977471042 4:97443396-97443418 AAAATTTAGCAAATGTCTTAAGG - Intronic
977605690 4:98983092-98983114 GAATTTCAACATATGAATTTGGG + Intergenic
977697691 4:99985013-99985035 GAATTTCAACATATGAATTTGGG - Intergenic
977972128 4:103224678-103224700 AAATTTCAAGAAAGGATTTAAGG + Intergenic
978036120 4:103997198-103997220 AAATTTTAAAAAATGTTTAATGG + Intergenic
978157942 4:105510660-105510682 CAATTCCAACAAATGTCTAAAGG + Intergenic
978315149 4:107427494-107427516 AAATTGCAACTCCTGTATTATGG + Intergenic
978375306 4:108068980-108069002 GAATTTCAGCATATGTATTTGGG - Intronic
978590210 4:110316491-110316513 ACATTTCAACAAAAATATAAAGG + Intergenic
978605406 4:110474248-110474270 ACATTTCAATAAATGTTTGATGG - Intronic
978643197 4:110896092-110896114 AGATTTCAACATATGCATTTTGG + Intergenic
978913895 4:114099853-114099875 AAGTTTCAACACATGAATTTTGG + Intergenic
979003921 4:115264291-115264313 AAATTTCAACATATATTTTGTGG - Intergenic
979009455 4:115348921-115348943 AATTTTCATCAAATGTATAAGGG + Intergenic
979018572 4:115466391-115466413 AGATTTCAACACATGAATTTGGG - Intergenic
979151408 4:117320832-117320854 AGATTTCAACATATGAATAAGGG - Intergenic
979210405 4:118094114-118094136 AAGTTTCAACATATGTATTGTGG + Intronic
979391592 4:120135216-120135238 TAATGTCAACCAATGTATTGAGG - Intergenic
979447699 4:120834241-120834263 AGATTTCAACATATGAATTTGGG - Intronic
979535416 4:121814300-121814322 AAATTTCAACTAAATTATTGTGG + Intronic
979616973 4:122753903-122753925 AAATTTCAACACATGAATTTTGG + Intergenic
979646052 4:123070681-123070703 AGATTTCAACATATGCATTTTGG + Intronic
979719598 4:123883283-123883305 AGATTTCAACATATGAATTTTGG - Intergenic
979759418 4:124382414-124382436 ATATTTCAAGAAATATATTTTGG - Intergenic
980014038 4:127628437-127628459 GTATTTCAACAAATGAATTTTGG + Intronic
980229187 4:130026174-130026196 AAATTTCAAAAACTGGAATAAGG + Intergenic
980248078 4:130273654-130273676 AAATTTCAAAATATATTTTATGG + Intergenic
980342659 4:131570203-131570225 AAATTTAAACAAATTGCTTAGGG - Intergenic
980492461 4:133545679-133545701 AAGTTTCAACATATGAATTTTGG + Intergenic
980533773 4:134088494-134088516 AAGTTTCAACACATGAATTTTGG - Intergenic
980638973 4:135547992-135548014 AATTTTCAACCAATTTTTTATGG - Intergenic
980985158 4:139687892-139687914 CAATTTTAAAAAATGTATTCTGG - Intronic
981050736 4:140306960-140306982 AGGTTTCAACATATGTATTTGGG - Intronic
981083612 4:140660452-140660474 CAATTTCAAAAAAGGTATTTTGG + Intronic
981390639 4:144186751-144186773 AAAGTTGAAAAAATATATTAAGG - Intergenic
981652992 4:147079989-147080011 TAATTTCTACAATTGTTTTAAGG - Intergenic
981686506 4:147460573-147460595 GAATTTCAACATATGAATTCTGG - Intergenic
981786081 4:148481065-148481087 AAGTTTCAACATATGCATTTTGG - Intergenic
981866580 4:149427587-149427609 AAGTTACAAAAAATGTATTAGGG - Intergenic
981871601 4:149493521-149493543 CAATTTCAACATATATATTTTGG - Intergenic
982165184 4:152607770-152607792 AGATTTCAACATATGAATTTTGG - Intergenic
982453870 4:155584815-155584837 AAATTCCAACATATGAATTTTGG + Intergenic
982666243 4:158268027-158268049 AAATTTCTACAAATGTTTAATGG + Intergenic
982734647 4:158992903-158992925 AAATTTCAACACCTGAATTTGGG + Intronic
982791763 4:159600405-159600427 AAATTTTAACATATGGCTTAAGG + Intergenic
982912217 4:161157978-161158000 AAAATTCAATAAATATATAAAGG - Intergenic
982953958 4:161739102-161739124 GAATTTCAACATATGAATTTGGG - Intronic
983267241 4:165521028-165521050 AAATATCAACATATGAATTTGGG - Intergenic
983635071 4:169889634-169889656 AAGTTTCAACATATGAATTTTGG - Intergenic
983711178 4:170717983-170718005 AAATGCCAAGAACTGTATTATGG + Intergenic
983814943 4:172112685-172112707 GAATTTCAACAAATGGATTTTGG - Intronic
983821219 4:172195383-172195405 GAATATCAACAAATATATTCAGG + Intronic
984056218 4:174932596-174932618 AAGTTTCAACATATGAATTTTGG + Intronic
984094981 4:175423745-175423767 AAAGTTCAACAAAAGCATAAGGG + Intergenic
984252956 4:177356222-177356244 ACATTTTAACTAATGAATTAGGG + Intronic
984346627 4:178536590-178536612 GAATTTCAACAAAGGGATGAAGG + Intergenic
985088713 4:186342117-186342139 AAATTTCCACATATGAATTTGGG + Intergenic
985465588 4:190192166-190192188 ATATTTCGACAAATGCATTGTGG + Intergenic
986165184 5:5266874-5266896 GAAATTCAATAATTGTATTATGG - Intronic
986218513 5:5744575-5744597 GAATTTCAACATATGAATTTTGG + Intergenic
986448783 5:7846625-7846647 TGATTTCAACATATGTATTTGGG + Intronic
986458273 5:7942142-7942164 AAATTTCCCCAAATTTATTCAGG - Intergenic
986990253 5:13544002-13544024 AGATGATAACAAATGTATTAAGG + Intergenic
987026338 5:13930385-13930407 AAATTTTAACAACTGGATTTGGG - Intronic
987098652 5:14573049-14573071 AAGTTTCAACATATGAATTACGG + Intergenic
987546524 5:19317038-19317060 AAATTTAAATAATGGTATTACGG - Intergenic
987671842 5:21019846-21019868 AAGTTTCTAAAAATTTATTATGG + Intergenic
987718202 5:21598380-21598402 AGATTTCAACATATGAATTTTGG + Intergenic
987888483 5:23843621-23843643 AAATTTTAACAGGTTTATTAAGG - Intergenic
988084753 5:26460669-26460691 AGATTTCAACATATGAATTTGGG + Intergenic
988210006 5:28191497-28191519 AAAGGTCAACAAATTTATTTTGG + Intergenic
988329540 5:29817621-29817643 TAATTTCAACAAATTTTGTATGG + Intergenic
988432086 5:31130672-31130694 GAATTTCAAAAAAAGAATTATGG - Intergenic
988515365 5:31899660-31899682 GGATTTCAACATATGAATTAGGG - Intronic
988566154 5:32321181-32321203 AAATTCCAACAAATCAATTTTGG - Intergenic
988774550 5:34466061-34466083 AAATTTCAAAAAATCATTTAAGG + Intergenic
988958468 5:36344271-36344293 AAAGTTCAACATATGAATTTTGG + Intergenic
989096314 5:37785084-37785106 AAATTTCAAGAAAGGATTTAAGG - Intergenic
989118366 5:37978585-37978607 GGACTTCAACAAATGTATTTTGG + Intergenic
989291909 5:39777435-39777457 AAATTTCAACATATGAATTTTGG - Intergenic
989399620 5:40994744-40994766 AGGTTTCAACAAATGAATTAGGG - Intergenic
989405093 5:41051536-41051558 AGATTTCAACATATGAATTTTGG - Intronic
989747058 5:44841621-44841643 ATACTTCAACAAATATCTTAAGG - Intergenic
989790725 5:45397208-45397230 AAATTTGAACAAATATATATTGG + Intronic
990076760 5:51855210-51855232 AGACTTCAACAAATGAATTTTGG - Intergenic
990100467 5:52178732-52178754 AAATTTCAACACGTGAATTTTGG + Intergenic
990246686 5:53870278-53870300 AAAAGTCATCAAAGGTATTAGGG - Intergenic
990388176 5:55289203-55289225 AAATGTCAAGAAATATATAATGG - Intronic
990427994 5:55707754-55707776 AAGTTTCAACATATGAATTTTGG - Intronic
990529235 5:56657325-56657347 AAATTTCAAAAGATGCCTTAAGG - Intergenic
990530778 5:56671331-56671353 AATTTTTAACAAATGTGTTGGGG - Intergenic
990662391 5:58030631-58030653 AAATTTAAAAACATTTATTATGG + Intergenic
990697161 5:58432697-58432719 AATTTTAAACAGAAGTATTAAGG + Intergenic
991005071 5:61820881-61820903 ACTTTTCAACAAAGGCATTAAGG + Intergenic
991177605 5:63708233-63708255 AAATTTCATCAAATCCATTAAGG + Intergenic
991278655 5:64883473-64883495 AAATGTCAACAATTATAATATGG + Intronic
991334751 5:65534595-65534617 AATTTTCAACAAAAGTGTAAAGG + Intronic
991440779 5:66646242-66646264 ATATTTAAAAAAATGTTTTATGG + Intronic
991464509 5:66895947-66895969 TGATTTTGACAAATGTATTAAGG - Intronic
991573996 5:68083873-68083895 AAATTTCAACATGTGAATTTTGG - Intergenic
991620690 5:68542582-68542604 AACTTTTAACAAATTTATTGAGG - Intergenic
991929073 5:71733780-71733802 AAGTTTCAACATATGAATTTTGG + Intergenic
991992746 5:72357554-72357576 AAATTTCAAAAAACTTATTGTGG + Intronic
992268203 5:75038787-75038809 AAATTTCAACACATGAATTTTGG + Intergenic
992332768 5:75734033-75734055 AGATTTCAAAATATGTATTTTGG + Intergenic
992408388 5:76481137-76481159 AAGTTTCAACATATGAATTTGGG + Intronic
992521221 5:77553492-77553514 AAGTTTCAACACATGAATTTTGG + Intronic
992586888 5:78250003-78250025 AAATTTCAACAAATTTCTGCAGG + Intronic
992989748 5:82272530-82272552 AAATTTCAAGAAAGGATTTAAGG - Intronic
993017267 5:82548800-82548822 AAATTTCTCCAAATGAATTTTGG + Intergenic
993040355 5:82807554-82807576 GAAGTTGAACAAATGCATTAAGG + Intergenic
993081575 5:83308031-83308053 AAAATTCCTCAAATGTATTTTGG + Intronic
993095688 5:83474984-83475006 AAAAGTCAACAAATGGAATACGG - Intronic
993130196 5:83887157-83887179 AAATTTCTACTTATGTATCAGGG + Intergenic
993159935 5:84277167-84277189 AAATTTCAACATATGAATCTTGG - Intronic
993172342 5:84435127-84435149 AGATTTCAACATATGAATTTGGG - Intergenic
993194919 5:84729806-84729828 AAATTTCAAAACAAGTATGAGGG - Intergenic
993233099 5:85264922-85264944 AAATTGTAACAAGTGTATAATGG + Intergenic
993393222 5:87347938-87347960 AAATGCAAACTAATGTATTAAGG - Intronic
993453843 5:88104944-88104966 GGATTTCAACAAATGAATTTTGG - Intergenic
993529374 5:89005202-89005224 AAATTAATAAAAATGTATTAGGG - Intergenic
993545760 5:89211206-89211228 CAATTTCAACATATGAATTTTGG - Intergenic
993557871 5:89364494-89364516 AAATTAGAACAAAATTATTAAGG + Intergenic
993704964 5:91159486-91159508 AAATTTTTAAAAATGTAATATGG - Intronic
993833021 5:92782844-92782866 AAATTTCAACAATTTTTTGAGGG - Intergenic
993874072 5:93285839-93285861 AAATTTTAACAAATTTTTAAAGG + Intergenic
994028410 5:95112808-95112830 AAGATGCAACAAATATATTATGG + Intronic
994114245 5:96044218-96044240 AGGTTTCAACACATGAATTAAGG - Intergenic
994695112 5:103064291-103064313 AAAATTCATCAATTTTATTAAGG + Intergenic
994712959 5:103287791-103287813 AAATATAACCAAAGGTATTATGG + Intergenic
994759533 5:103835629-103835651 AAGTTTCAACAAATGAATTTGGG - Intergenic
994803457 5:104411498-104411520 AAAATTTAAAAAATGTATTTGGG + Intergenic
994897900 5:105728749-105728771 AACTTTCAACAAAGTTATAAGGG + Intergenic
994917288 5:105996234-105996256 CAATTTAACCAAGTGTATTAGGG - Intergenic
995090068 5:108163699-108163721 AGATTTTAAAAAATGTTTTAAGG - Intronic
995322443 5:110851755-110851777 GAGTTTCAACATATGTATTTTGG - Intergenic
995765139 5:115606346-115606368 AAATTTGAACAAATCAATGATGG + Intronic
995819021 5:116206184-116206206 AAATTTGTACAAATTTATTATGG + Intronic
995823340 5:116263946-116263968 AAATCTCTTCAAATGTTTTACGG + Intronic
995890817 5:116948370-116948392 AAATTTTAAGAAATTCATTAAGG - Intergenic
996372105 5:122764282-122764304 AAATTTTAAAAACTCTATTAAGG - Intergenic
996467457 5:123820338-123820360 AAGTTTCAACATATGAATTTTGG - Intergenic
996469624 5:123844713-123844735 ATATTTCAACATATGAATTTTGG + Intergenic
996653071 5:125904966-125904988 AAATTACAAGAAATGTATTTTGG - Intergenic
996761119 5:126986891-126986913 AAATTTCAACAAATTTCTGGAGG + Intronic
997044319 5:130295415-130295437 AAATTTCAGCAAATGAAACAAGG + Intergenic
997066019 5:130559900-130559922 AAATTTTACCAAATATATAAAGG + Intergenic
997170497 5:131714376-131714398 AACATGCAACAATTGTATTAGGG - Intronic
998288771 5:140891710-140891732 AATTTTCAACACATGAATTTGGG - Intronic
998363615 5:141613248-141613270 AAATTTAAACAAATATTTAAAGG + Intronic
998519430 5:142786280-142786302 ACTTTTTAAAAAATGTATTAGGG - Intronic
998700750 5:144696813-144696835 AGTTTTCAACACATGAATTATGG - Intergenic
998871248 5:146554716-146554738 AAGTTTCAACACATGAATTTTGG + Intergenic
999066046 5:148686589-148686611 GGATTTCAACATATGAATTAGGG - Intergenic
999100572 5:149021830-149021852 GAATTTCATCAAATGTTTAAAGG + Intronic
999886704 5:155932098-155932120 AGATTTCAACATATGAATTTTGG + Intronic
1000503397 5:162081261-162081283 AAATTTCCACAAATATCTAATGG + Intronic
1000537303 5:162494408-162494430 AAATTTGATCAAATGCAATAAGG + Intergenic
1000740792 5:164968079-164968101 AAATTTCATCAATTGTAGCAAGG - Intergenic
1000897725 5:166876403-166876425 ACATTTCAAGCAATATATTATGG - Intergenic
1001116001 5:168940578-168940600 AAATACCAACCATTGTATTATGG + Intronic
1001465587 5:171962341-171962363 AAATTATAACAAATGTATCTTGG - Intronic
1001615003 5:173036138-173036160 ACATTTCAACAATAGTATGATGG - Intergenic
1002745696 5:181470165-181470187 ATATTTCGACAAATGCATTGTGG + Intergenic
1002999355 6:2317033-2317055 AAATTTCAAGAAAGGATTTAAGG - Intergenic
1003058644 6:2844572-2844594 AAGTTTCAACATATGAATTTTGG + Intergenic
1003155196 6:3587925-3587947 GAATTTCAACATATGGATTTTGG + Intergenic
1003612999 6:7630194-7630216 GAATTTCAACATATGAATTTTGG - Intergenic
1003621430 6:7704510-7704532 GGATTTCAACAGATGAATTAGGG - Intergenic
1003626212 6:7744017-7744039 AAATTTCAACATATGGAAAAAGG + Intronic
1003779731 6:9411296-9411318 AAGTTTCAACACATGAATTTTGG - Intergenic
1003801620 6:9676142-9676164 AAATTTCCACAGATATATAAAGG - Intronic
1003906038 6:10700479-10700501 AAGTTTCAGCAAATGAATTTTGG + Intronic
1003946190 6:11078139-11078161 AAGTTTCAACATATGAATTTTGG - Intergenic
1003951543 6:11120567-11120589 AAATTTCAATATATGAATTTTGG + Intronic
1004971043 6:20910666-20910688 GAATTTCAAAATATGTATTTTGG - Intronic
1005406431 6:25493323-25493345 TAATTTCAACAAAATTACTAAGG - Intronic
1005600400 6:27421169-27421191 AGATTTGAACAAATGTATAGTGG - Intergenic
1005656159 6:27939833-27939855 AAATTTCTGCAAATGAATAAGGG + Intergenic
1005800384 6:29416264-29416286 CTATTTCAAAAAATGTATAAAGG + Intronic
1006330451 6:33386597-33386619 AAATGTCAACATATGAATTTTGG - Intergenic
1006570538 6:34999541-34999563 AAATTTCAAGAAAGGATTTAAGG + Intronic
1006869288 6:37235924-37235946 AAGTTTCAACACATGAATTTTGG + Intronic
1006969565 6:38027538-38027560 AAATATCAATGAATGTACTAAGG + Intronic
1007165913 6:39828920-39828942 AAGTTTCAACATATGCATTTTGG + Intronic
1007434704 6:41801115-41801137 AAATTTCAGCAAATAAATAATGG + Intronic
1008007341 6:46424865-46424887 AAATTTAAACAAATGCATATTGG + Intronic
1008123233 6:47641444-47641466 AAATTTCAAGAAAGGATTTAAGG + Intergenic
1008692239 6:53992551-53992573 AAGTTTCAACACATGCATTTTGG + Intronic
1008730628 6:54478503-54478525 AAAAATCTACATATGTATTATGG - Intergenic
1008925269 6:56885518-56885540 AAATTTCAACACATGAATTTTGG - Intronic
1008953987 6:57194114-57194136 TAATATTAACAAATGTATAATGG + Intronic
1009304165 6:62066062-62066084 ATATTTATACAACTGTATTAGGG + Intronic
1009355269 6:62736470-62736492 GAATTTCAACATATGAATTCAGG + Intergenic
1009394279 6:63179941-63179963 ATATTTTAACAAATATTTTATGG - Intergenic
1009519623 6:64664573-64664595 AGATTTCAACATATGAATTTGGG - Intronic
1009721672 6:67479684-67479706 CAATTTGAACAAATATAATATGG - Intergenic
1009757719 6:67961271-67961293 AAATTCCAACAAATTGATTAAGG - Intergenic
1009834133 6:68975623-68975645 AAAGTTAAACATATGCATTATGG + Intronic
1009841838 6:69087389-69087411 AAGTTTCAACATATGAATTTTGG - Intronic
1009872023 6:69465379-69465401 AGATTTCAACATATGCATTTTGG - Intergenic
1009977122 6:70683102-70683124 CATTTTCACCAACTGTATTAAGG - Intronic
1011035951 6:82975023-82975045 AAATTTAAACAAAAGTATTTTGG - Intronic
1011198610 6:84808989-84809011 AAAGTTCAATAAATGTGTTGAGG - Intergenic
1011284444 6:85707923-85707945 AAGTTTCAACACATGAATTTTGG - Intergenic
1011287215 6:85737938-85737960 GGATTTCAACAAATGGATTTGGG - Intergenic
1011753675 6:90478024-90478046 AAGTTTCAACACATGAATTTGGG - Intergenic
1011890220 6:92149990-92150012 AAGCTTCAACAAATGAATTCTGG - Intergenic
1012896872 6:104958492-104958514 AAATTTCACTATATATATTAAGG + Intronic
1012969135 6:105707853-105707875 AGATTTCAGCAAATGAATTTTGG - Intergenic
1013082894 6:106828179-106828201 GAATTTCAACATATGAATTTTGG - Intergenic
1013142776 6:107355510-107355532 AATTTTCAAAAATTGTATTATGG - Intronic
1013160663 6:107541323-107541345 ACATTTCAACATATTTATGAAGG - Intronic
1013187770 6:107775918-107775940 AAAGTGCAACAAATGATTTATGG + Intronic
1013211266 6:107989016-107989038 AAATCTCTTCAAATATATTACGG + Intergenic
1013446880 6:110238159-110238181 ATATTTCAACATATGAATTTTGG + Intronic
1013640934 6:112080175-112080197 AAATTTAAACAAACCTATTCTGG + Intronic
1013710944 6:112897695-112897717 GGATTTCAACAAATGAATTTTGG + Intergenic
1013777117 6:113690566-113690588 AAGTTTTAAGAAATGTATGATGG + Intergenic
1013856247 6:114576162-114576184 AAATTTGAAGAAATACATTACGG - Intergenic
1014336419 6:120142393-120142415 AACTTTCAACATATGAATTTTGG - Intergenic
1014471094 6:121815913-121815935 ACATTTCAACATATGAATTTTGG - Intergenic
1014611198 6:123549299-123549321 AAATGCAAACAAATATATTAGGG + Intronic
1014642175 6:123926153-123926175 AGATTTCAACATATGAATTTGGG + Intronic
1014644703 6:123958631-123958653 AAATTTCAACATATGAATTTTGG + Intronic
1014653076 6:124065396-124065418 AAGTTTCAACATATGAATTTTGG - Intronic
1014680465 6:124423562-124423584 AAGTTTCAACATATGCATTTGGG - Intronic
1014699011 6:124660222-124660244 AAATTTCCACCTATGTTTTAAGG + Intronic
1014829301 6:126082642-126082664 AAACTTTATCAAATGTATAATGG + Intergenic
1014850767 6:126337223-126337245 AGATTTCAACATATGAATTTTGG + Intergenic
1015004751 6:128265817-128265839 AAATTTCAACATAAGAATTTTGG - Intronic
1015479862 6:133696830-133696852 AAATTTCAGCAAAAGTTTGAGGG - Intergenic
1015550386 6:134405988-134406010 CAAGTTCAACTAATGTATGAAGG - Intergenic
1015776385 6:136818986-136819008 AAATTTCAACATATGAATTTGGG + Intergenic
1016148616 6:140707464-140707486 AAGCTTCAAGAAATGTAATATGG - Intergenic
1016177807 6:141101342-141101364 GAATTTCAACATATGAATTTGGG - Intergenic
1016443198 6:144106082-144106104 AAATGTCAACAAATGAATTTTGG + Intergenic
1016527201 6:145015494-145015516 AAATTTCAGGAAACATATTATGG - Intergenic
1016615410 6:146042166-146042188 AAATTTCAACACATGGATTTTGG + Intronic
1016716586 6:147239237-147239259 AAATTTAAGCGAATGTAGTATGG - Exonic
1016973904 6:149788255-149788277 AGATTTCAAAAATTGTACTATGG - Intronic
1017028256 6:150199294-150199316 AAATTTCAACACCTGAATTTTGG - Intronic
1017186988 6:151611609-151611631 GAATTTCAACATATGAATTTAGG + Intronic
1017350388 6:153434090-153434112 AAATTTCAACACATATTTTTGGG + Intergenic
1017489081 6:154928495-154928517 AGATTTCAACATTTGTATAAAGG + Intronic
1017681510 6:156868705-156868727 AGATTTCAACATATGAATTTTGG + Intronic
1018146657 6:160897871-160897893 AAATTTCAACACATATTTTTGGG - Intergenic
1018382995 6:163276600-163276622 AGATTTCAACATATGCATTTTGG - Intronic
1018483155 6:164212553-164212575 AAATTTCAACATGTGAATTTGGG + Intergenic
1018564129 6:165133685-165133707 AGATTTCAACATATGAATTTTGG - Intergenic
1019250613 6:170743720-170743742 ATATTTCGACAAATGCATTGTGG + Intergenic
1019871609 7:3769033-3769055 AAAATTCAACAAAGGTTTTAGGG - Intronic
1020366604 7:7387108-7387130 AAATTTCAACATATGAATGTGGG + Intronic
1020395505 7:7712371-7712393 AATTTTACAAAAATGTATTAAGG - Intronic
1020569597 7:9842610-9842632 AAATATCAACGACTCTATTATGG - Intergenic
1020873073 7:13657903-13657925 AAATTGCAAAATATGAATTATGG + Intergenic
1020883117 7:13787867-13787889 AAATTTTAGCAAATGTATTTTGG - Intergenic
1020986413 7:15140658-15140680 AAACTTCAACCCATATATTAAGG + Intergenic
1021022235 7:15616259-15616281 AAATTGCAACAAATACATAATGG + Intronic
1021173754 7:17426114-17426136 AAGTTTCAACAAATGAATTTTGG - Intergenic
1021409670 7:20315768-20315790 AGATTTCAACATATGAATTCTGG - Intergenic
1021412777 7:20346914-20346936 AGATTTCAACACATGAATTTTGG - Intronic
1021436481 7:20623234-20623256 CAATTTTAACAAATGTATTATGG - Intronic
1021895447 7:25230733-25230755 ACATTTCAACAAAAGATTTATGG - Intergenic
1022283715 7:28935304-28935326 AAGTTTCAACATATGAATTTGGG + Intergenic
1022361302 7:29661500-29661522 AAATTGGAAATAATGTATTAAGG - Intergenic
1022477161 7:30719021-30719043 AGAATTGAACAAATGTATAATGG + Intronic
1022489893 7:30808583-30808605 AAATTTCAAGAAAGGATTTAAGG + Intronic
1022525724 7:31035786-31035808 AAGTTTCAACAAATGAATTCTGG + Intergenic
1022562093 7:31360040-31360062 ATATTTCATCATATGTATTATGG + Intergenic
1022668373 7:32431910-32431932 ATATTTCAACATATGAATGAGGG + Intergenic
1022796766 7:33737978-33738000 GAATTTCAACATATGAATTTTGG - Intergenic
1022843050 7:34182808-34182830 AGATTTCAACATATGAATTAGGG - Intergenic
1023368824 7:39491590-39491612 AAGTTTCAACACATGAATTTTGG - Intronic
1023770444 7:43552017-43552039 AGATTTCAACATATGAATTTGGG + Intronic
1023989574 7:45120270-45120292 AGATTTCAACATATGAATTTTGG + Intergenic
1024144275 7:46496295-46496317 AAGTTTAGACAAATGTATAATGG - Intergenic
1024722091 7:52148763-52148785 AAATGTCAAAAAATATATTTGGG - Intergenic
1025792746 7:64706135-64706157 AATTTTCCACAAATGTATTTTGG + Intronic
1025803850 7:64810543-64810565 CAATTTAAACAAATCTCTTAGGG - Intronic
1025817365 7:64927465-64927487 AATTTTCCACAAATGTATCTTGG + Intronic
1025866233 7:65384149-65384171 CAATTTAAACAAATCTCTTAGGG - Intronic
1026028472 7:66767556-66767578 GAATTTCAACATATGAATTTGGG - Intronic
1026541708 7:71285534-71285556 CAATTTCAACATATGAATTTTGG - Intronic
1026732964 7:72927217-72927239 ACATTTCTACAAAAGTATGAGGG - Intronic
1027057365 7:75059030-75059052 AAATTACAAAAAAATTATTAGGG + Intronic
1027418898 7:78000947-78000969 AAATTTCAACAAAGGTACAATGG - Intergenic
1027719250 7:81718357-81718379 CAATTTCCACAAATGTAATATGG - Intronic
1027992550 7:85380938-85380960 AAGTTTCAACATATGAATTTTGG + Intergenic
1028006535 7:85577188-85577210 TAATTTCAATAAATGTGTTGTGG - Intergenic
1028289117 7:89043659-89043681 ACATTTTAACAAATGTACTGTGG + Intronic
1028293070 7:89092301-89092323 ACATTTCAACATATGAATTTTGG + Intronic
1028334982 7:89640870-89640892 AAAATTCAGCAAATATATTCTGG + Intergenic
1028485909 7:91357079-91357101 AAGTTTCAACATATGAATTCTGG - Intergenic
1028776859 7:94687430-94687452 AGATTTCAACATATGAATTTTGG + Intergenic
1028896470 7:96047251-96047273 AAGTTTCAACATATGAATTTTGG + Intronic
1028958536 7:96722157-96722179 AAATATCAGCAATTGTATTGTGG + Intergenic
1029639622 7:101812204-101812226 AAAATTCAGAAAATGCATTAAGG + Intergenic
1029825587 7:103189764-103189786 AATTTTTAAAAAATGTTTTAAGG - Intergenic
1029870238 7:103683329-103683351 ATAGTTCAACAAATGAATGAGGG + Intronic
1030145511 7:106350088-106350110 GAATTTCAACATATGAATTTGGG - Intergenic
1030308314 7:108042042-108042064 AGATTTCAAGAAAAATATTAGGG + Intronic
1030568320 7:111188553-111188575 AGATTTCAACATATGAATTTGGG + Intronic
1030569524 7:111205296-111205318 AAGTTTCAACATATGAATTCTGG + Intronic
1030765960 7:113409961-113409983 AAATATCAACTAAAGTATTATGG + Intergenic
1030786951 7:113674240-113674262 AAATTTTAACATATGAATTTTGG - Intergenic
1030955510 7:115847136-115847158 AAATTTCTACAAGCCTATTAAGG + Intergenic
1031241856 7:119255241-119255263 AAATTTCAGCATTGGTATTAGGG - Intergenic
1031256650 7:119459965-119459987 AAATAGCTACAAATGTAGTAGGG + Intergenic
1031357752 7:120808818-120808840 GAATTTCAACATATGCATTTGGG - Intronic
1031385577 7:121146393-121146415 AAGTTTCAACACATGAATTTTGG + Intronic
1031548204 7:123076604-123076626 AAGTTTCAACATATGAATTTGGG - Intergenic
1031741798 7:125442186-125442208 ACATTGCAACACATGAATTATGG + Intergenic
1031808928 7:126341427-126341449 ACATTTCAACAAATATATGAAGG - Intergenic
1032451944 7:132039256-132039278 AAGTTTCAACTAATTTTTTATGG - Intergenic
1033578623 7:142711243-142711265 AAATTTTAAAAGATGTATTTTGG + Intergenic
1033625040 7:143102018-143102040 AAATTTCAAAATATGAATTTGGG + Intergenic
1033853759 7:145531587-145531609 CAATTTCAACATATGAATTTTGG - Intergenic
1034320701 7:150178770-150178792 AAATGTCAACCAATGAATTGTGG + Intergenic
1034772034 7:153788478-153788500 AAATGTCAACCAATGAATTGTGG - Intergenic
1034839094 7:154379133-154379155 AATTATCAACACATGTGTTATGG - Intronic
1035699204 8:1625814-1625836 GAATTTCATCAAAAGTAATAGGG - Intronic
1036093860 8:5701677-5701699 AAATTTTAACAAATTTTTAAGGG - Intergenic
1036565698 8:9936050-9936072 AAATGTCAACTAATTTATGATGG - Intergenic
1037045600 8:14298618-14298640 AAATTTCAACAAATATAAGCAGG + Intronic
1037074090 8:14691334-14691356 AAATCTCTACAAATGCATTTAGG + Intronic
1037130624 8:15404259-15404281 AAGTTTCAACATATGAATTTGGG + Intergenic
1037392691 8:18410768-18410790 AAATTTCACCAGATGTACAAAGG + Intergenic
1037495140 8:19433021-19433043 ACATTTAAAAAAATGTATTATGG + Intronic
1037610670 8:20473602-20473624 TGATTTCAACAAATGAATTTGGG - Intergenic
1037669389 8:21001293-21001315 AAAATTCAACATATGAATTTTGG - Intergenic
1037791146 8:21943498-21943520 AAATTTCTTCAAATAAATTATGG - Intronic
1037977989 8:23226533-23226555 TAATTTCAACAAAAGTGATAAGG - Intergenic
1039821734 8:41140989-41141011 AAATTTCAACAGAAGTGTGAGGG + Intergenic
1040366658 8:46724281-46724303 AGATTTCAACATATGAATTTGGG + Intergenic
1040462545 8:47662751-47662773 AGATTTCAACATATGAATTTTGG - Intronic
1040666816 8:49643377-49643399 GAATTTCAACATATGAATTGAGG + Intergenic
1040757510 8:50797097-50797119 AAGTTTCAACCAGTGTAATATGG - Intergenic
1040963075 8:53055607-53055629 AAATTAAAATAAATGTTTTAAGG - Intergenic
1040971913 8:53144420-53144442 AGATTTCAACATATGAATTTTGG + Intergenic
1041350497 8:56943430-56943452 AAGTTTCAACATATGAATTTGGG - Intergenic
1041777971 8:61545127-61545149 AGATTTCAACATATGAATTTGGG - Intronic
1042027926 8:64443647-64443669 GGATTTCAACAAATGAATTTGGG - Intergenic
1042188628 8:66163014-66163036 GAATTTCTACAAAAGTATTAAGG - Intronic
1042211444 8:66385092-66385114 AATTTAGAACAAATGTATTATGG + Intergenic
1042317759 8:67442539-67442561 CAATATCAACAAAAGTATAAAGG + Intronic
1042426421 8:68653777-68653799 AGATTTCAACATATGAATTCAGG + Intronic
1042575695 8:70216197-70216219 AAATTTCATCTCATATATTATGG - Intronic
1043108590 8:76148614-76148636 AAGCATCAACCAATGTATTAAGG - Intergenic
1043244711 8:77982712-77982734 AAATTTCACCCAATTTCTTATGG + Intergenic
1043310617 8:78854613-78854635 AAATTTTAAAACATGTATTCTGG + Intergenic
1043642405 8:82471567-82471589 CAATTTCAACATATGAATTTTGG + Intergenic
1044152135 8:88794175-88794197 AAATTTCAACATATGAATTTGGG - Intergenic
1044155619 8:88842418-88842440 AAATTTTAACAAATTCATAAAGG + Intergenic
1044157166 8:88861994-88862016 AAATTAAGACAAATGTATTCAGG + Intergenic
1044423183 8:92022418-92022440 AAGTTTCAACACATGAATTTTGG - Intronic
1044518632 8:93170456-93170478 AAATTTTAAATAATGTATTTTGG + Intergenic
1044542742 8:93425983-93426005 AAGTTTCAACATATGAATTTAGG + Intergenic
1044662430 8:94604666-94604688 AAGTTTCAACATATGAATTTTGG + Intergenic
1044791850 8:95856052-95856074 AAATTTCTACAATTGTTTAAAGG - Intergenic
1044811067 8:96062717-96062739 AGATTTCAACATATGAATTTGGG + Intergenic
1044921043 8:97169795-97169817 AAGTTTCAACATATGAATTTTGG + Intergenic
1045844603 8:106618769-106618791 ACATTTAAACAAATGTTTAAGGG - Intronic
1046012370 8:108565088-108565110 AAATTTTAAAAAATAGATTATGG - Intergenic
1046105707 8:109663660-109663682 ACATTTTAAAAAATGTACTAGGG - Intronic
1046238851 8:111464083-111464105 AGATTTCAACATATGAATTTTGG + Intergenic
1046253173 8:111661015-111661037 AAAAATCAATAAAAGTATTATGG + Intergenic
1046690686 8:117281237-117281259 AAATTTAAACAGATTAATTATGG - Intergenic
1046759251 8:118004169-118004191 AAATTTAAACAATAGTAGTAAGG - Intronic
1046774550 8:118150315-118150337 AAATTGCAACAATAGTATAAGGG - Intergenic
1047137068 8:122091446-122091468 AAATTTCAACATATACATTTTGG - Intergenic
1047482774 8:125300690-125300712 AAAGTTCAGCAAGTGTATTATGG + Intronic
1047551900 8:125883184-125883206 AAATTTCAACATATGGATTTTGG - Intergenic
1047660493 8:127029016-127029038 CAATTTAAACAAATTTATAATGG + Intergenic
1048049959 8:130807392-130807414 AAGTTTCAACATATGAATTTGGG - Intronic
1048537103 8:135307080-135307102 TAATTTCCACAAATGCATTGTGG + Intergenic
1048562075 8:135550501-135550523 AATTTTCAACAATGGTACTAAGG - Intronic
1048874610 8:138827236-138827258 AGATTTCAACATATGGATTTAGG - Intronic
1049083760 8:140461980-140462002 AAATTTAAACATATGAATTTGGG + Intergenic
1050063127 9:1731239-1731261 AAATGTCAACATATGAATTTTGG + Intergenic
1050408184 9:5332153-5332175 AAATTTCAACAAATTAAATTGGG - Intergenic
1050778564 9:9300501-9300523 CAATTTCAACACATGAATTTGGG - Intronic
1051234331 9:14982573-14982595 AAATTTCAACATAAGTTTTGGGG + Intergenic
1051293209 9:15566940-15566962 AATTTTCAACAGAAGTATCAAGG - Intronic
1051943738 9:22540520-22540542 AAATTTTAAAAAGTGTATAAAGG - Intergenic
1052299840 9:26941643-26941665 CAATTTAAAAAAATGTTTTAAGG - Intronic
1052427766 9:28326975-28326997 ATTTTTCAACAAATGAATTTTGG - Intronic
1052682598 9:31713309-31713331 AAATTCCAAAAAATGTATTGGGG - Intergenic
1052891959 9:33709720-33709742 AAATTTTAAAATATGTATTTTGG + Intergenic
1053185849 9:36015789-36015811 AAGTTTCAACATATGAATTTAGG + Intergenic
1054733753 9:68729128-68729150 TAATTGCAAGAAATGCATTAGGG + Intronic
1054754820 9:68946995-68947017 TTATTTCAACAAATGTTTTATGG - Intronic
1054923830 9:70568398-70568420 ACATTTTAAAAAAGGTATTAAGG + Intronic
1055230654 9:74060825-74060847 AAAGTTCAATAAATGATTTATGG - Intergenic
1055492090 9:76815597-76815619 AAATTTCAACATATACATTTTGG + Intronic
1055738174 9:79355796-79355818 GAATTTCAACATATGAATTTTGG - Intergenic
1056174543 9:84021211-84021233 AAATTTCAACAAGAGTTTTGCGG + Intergenic
1056236173 9:84596976-84596998 AAGTTTCAACATATGAATTTTGG - Intergenic
1056736132 9:89210809-89210831 GAATTTCAACAGATGAATTTAGG + Intergenic
1056775801 9:89511833-89511855 AAGTTTCAACATATGAATTTGGG - Intergenic
1056789949 9:89618804-89618826 GGATTTCAACAGATGTATTAGGG - Intergenic
1056985005 9:91355118-91355140 ACATTTTAAGAAATGTATTAAGG + Intronic
1057740017 9:97703212-97703234 GAGTTTGAACAAATGTATAATGG + Intergenic
1057767742 9:97937693-97937715 AAATTTAAAACAATGTCTTAAGG + Intronic
1057968730 9:99531918-99531940 AAGTTTCAACATATGAATTTTGG - Intergenic
1058032253 9:100213182-100213204 GAATTTCAACACATGAATTGGGG + Intronic
1058095827 9:100859249-100859271 AGATTTCAACATATGAATTTTGG + Intergenic
1058317825 9:103590523-103590545 AAATTTCAAGTCATGTGTTATGG + Intergenic
1058358624 9:104114224-104114246 ACATTTCAACAAATGTTTAAAGG - Intronic
1058739482 9:107929025-107929047 AGATTTCAACATATGAATTTAGG - Intergenic
1058794821 9:108487972-108487994 AAATTTCAACACATGGATTTGGG + Intergenic
1058855837 9:109061367-109061389 AAATGGAAACAATTGTATTAAGG - Intronic
1058977809 9:110140947-110140969 AAGTTTCAACAAATGAATAATGG + Intronic
1059280164 9:113126130-113126152 AAATTTAAAAAAAGATATTAGGG - Intergenic
1059489450 9:114655103-114655125 AGATTTCAACACATGAATTTGGG - Intergenic
1059545524 9:115172146-115172168 AAACTTCAAAGAATCTATTAAGG + Intronic
1059564724 9:115372293-115372315 GAATTTCAACATATGAATTTGGG + Intronic
1059851550 9:118346747-118346769 AAAATTCAACATATGAATTTTGG - Intergenic
1059910176 9:119034528-119034550 AAGTTTCAACATATGAATTTGGG + Intergenic
1059910358 9:119036968-119036990 GAATTTCAACATATGAATTTTGG - Intergenic
1060262588 9:122089615-122089637 AATATTCATCAAATGAATTATGG - Intronic
1060379043 9:123148153-123148175 AAGTTTCAACATATGAATTTTGG - Intronic
1060380224 9:123162791-123162813 AAATATAAACAAATGTACCACGG + Intronic
1060898372 9:127234927-127234949 AAGTTTCAACATATGAATTTTGG + Intronic
1203580168 Un_KI270745v1:36317-36339 ATATTTCGACAAATGCATTGTGG + Intergenic
1185558341 X:1038973-1038995 AAATTTCAACACTTGCATTCTGG + Intergenic
1186149857 X:6663534-6663556 GATTTTCAAATAATGTATTAAGG - Intergenic
1186558798 X:10588956-10588978 AAATTTCAAGAAAGGATTTAAGG - Intronic
1186602974 X:11058186-11058208 AAATTTTAACAAAAGTTTAATGG + Intergenic
1186870779 X:13769618-13769640 AAATTCCAACATATGAATTTTGG - Intergenic
1187202740 X:17150921-17150943 AAATTTGAAAACATGTTTTAGGG + Exonic
1187263938 X:17713578-17713600 ACATTTTAACAGATGTATTTTGG + Intronic
1187892437 X:23948773-23948795 GAATTTCAACATATGAATTGGGG + Intergenic
1188351594 X:29137932-29137954 AAAAGTCAACAAAAATATTAGGG - Intronic
1188700575 X:33256252-33256274 AAATATTAGCAAATATATTAGGG + Intronic
1188936760 X:36185364-36185386 AGATTTCAACAAATGAATTGAGG + Intergenic
1188951658 X:36383185-36383207 GAATTTCAATAAATGTAATTGGG + Intronic
1189144995 X:38646705-38646727 AAATTTCAAAAATTGCATTAAGG + Intronic
1190135730 X:47795889-47795911 AGATTTCAACATATGAATTTTGG - Intergenic
1190770964 X:53513720-53513742 AAATTTCAAGAAAGGATTTAAGG + Intergenic
1190791145 X:53701525-53701547 AAATTTGAACAGATTTATGAAGG + Intergenic
1190791697 X:53706621-53706643 AAATTTGAACAGATTTATGAAGG + Intergenic
1191085210 X:56559791-56559813 AAATTTGCAGAAATATATTAGGG - Intergenic
1191918217 X:66225222-66225244 AAATTTCAAGAAAGGATTTAAGG - Intronic
1192130476 X:68545091-68545113 AATATGCAAGAAATGTATTAAGG - Intergenic
1192275286 X:69623507-69623529 ATATTTCAACATATGAATTTTGG + Intronic
1192501722 X:71658482-71658504 AAATTTAAACAAATGCAATCTGG + Intergenic
1192508814 X:71709514-71709536 AAATTTAAACAAATGCAATCTGG + Intergenic
1192517883 X:71772039-71772061 AAATTTAAACAAATGCAATCTGG - Intergenic
1192616788 X:72633181-72633203 AAGTTTCAACAAACGAATTTGGG - Intronic
1193256053 X:79350488-79350510 ACATTTCAACACATGAATTTTGG - Intergenic
1193450643 X:81660508-81660530 ATATTTCAACCAATGAATAATGG + Intergenic
1193599310 X:83489889-83489911 AAATTTTAGCAAATTTATTTAGG + Intergenic
1193717096 X:84945732-84945754 AAATTTCAAGAAAGGATTTAAGG + Intergenic
1193794838 X:85861382-85861404 AAATTTCAACACATTTTTTTTGG + Exonic
1193797453 X:85893494-85893516 ATATGTCAACAAATGAATTGTGG - Intronic
1194083904 X:89502469-89502491 AAGTTTCAACATATGAATTATGG - Intergenic
1194119243 X:89939536-89939558 AAATTTCAAAAACTATATTGTGG + Intergenic
1194354697 X:92868226-92868248 AAATTTCAACAAATACATATGGG - Intergenic
1194564856 X:95472741-95472763 GGATTTCAACAAATGAATTTAGG + Intergenic
1194577623 X:95633110-95633132 AAATTTCTACATATGTTCTAAGG - Intergenic
1194642665 X:96421677-96421699 AAGTTTCAACATATGAATTTTGG + Intergenic
1194706206 X:97178725-97178747 ACATTTCAACACATGAATTTTGG - Intronic
1194721148 X:97341433-97341455 AAATTTTATCTATTGTATTAGGG + Intronic
1194731200 X:97457709-97457731 ATGTTTCAACATATGTATTTTGG - Intronic
1194897805 X:99467670-99467692 AAAGTTCATTAAATGTATTATGG + Intergenic
1195138688 X:101936362-101936384 AAGTTTCAACATATGAATTTTGG + Intergenic
1196130881 X:112154866-112154888 AAATTTCAATACATGAATTTTGG - Intergenic
1196460340 X:115923164-115923186 AAATTTCAAGAAAGGATTTAAGG - Intergenic
1197012490 X:121583442-121583464 AACTTTAAACAAAGATATTATGG - Intergenic
1197013154 X:121591696-121591718 AGGTTTCAACACATGTATTTTGG - Intergenic
1197494311 X:127158810-127158832 ATATTTCAACAACTGTTTTGAGG - Intergenic
1197651792 X:129073227-129073249 AGATTTCAACATATGAATTTTGG - Intergenic
1197900064 X:131361351-131361373 AAATTTCAACAAATTAAATTGGG + Intronic
1198055328 X:132989241-132989263 TATTTTCAAAAATTGTATTAAGG + Intergenic
1198541379 X:137643744-137643766 GAATTTCAACATATGAATTTTGG + Intergenic
1198550276 X:137737685-137737707 GAATTTGAACAAATGCATAATGG + Intergenic
1198780669 X:140232180-140232202 AAGTTTCAACATATGAATTCTGG + Intergenic
1198794695 X:140383050-140383072 GGATTTCAACAAATGAATTTCGG + Intergenic
1198879020 X:141258628-141258650 TACTCTCAACAAATGTATTCAGG - Intergenic
1199225322 X:145366187-145366209 AAGTTTCAACATATGAATTTTGG + Intergenic
1199286318 X:146058459-146058481 AAAATACAACAAATCTATTTTGG - Intergenic
1199736040 X:150687616-150687638 AAATTTCAACAAGTGAATACTGG - Intergenic
1199840362 X:151640655-151640677 AATTTTCCACAAATATATGATGG + Intronic
1200436551 Y:3158349-3158371 AAGTTTCAACATATGAATTATGG - Intergenic
1200472116 Y:3597095-3597117 AAATTTCAAAAACTATATTGTGG + Intergenic
1200823782 Y:7618216-7618238 CAATTTTAAGAAATGTTTTAAGG + Intergenic
1201066179 Y:10096970-10096992 AAATTTTAACAGATGTACAAAGG - Intergenic
1201260298 Y:12152750-12152772 AAATTTCAAGAAAAGATTTAAGG - Intergenic
1201559661 Y:15302620-15302642 AAATTAAAACAAAAGTAATAAGG - Intergenic
1202236274 Y:22712872-22712894 CAATTTTAAGAAATGTTTTAAGG - Intergenic
1202306891 Y:23483296-23483318 CAATTTTAAGAAATGTTTTAAGG + Intergenic
1202563916 Y:26187290-26187312 CAATTTTAAGAAATGTTTTAAGG - Intergenic