ID: 1074329237

View in Genome Browser
Species Human (GRCh38)
Location 10:112487422-112487444
Sequence CCTAATCTTGCATTTTTGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074329231_1074329237 17 Left 1074329231 10:112487382-112487404 CCAAAGTGCTGGGCTTACAGGTG 0: 187
1: 70955
2: 206272
3: 250934
4: 204491
Right 1074329237 10:112487422-112487444 CCTAATCTTGCATTTTTGAGAGG No data
1074329233_1074329237 -10 Left 1074329233 10:112487409-112487431 CCACCGTGCCTGGCCTAATCTTG 0: 3
1: 17
2: 377
3: 2569
4: 12911
Right 1074329237 10:112487422-112487444 CCTAATCTTGCATTTTTGAGAGG No data
1074329230_1074329237 18 Left 1074329230 10:112487381-112487403 CCCAAAGTGCTGGGCTTACAGGT 0: 191
1: 74250
2: 305136
3: 245902
4: 149695
Right 1074329237 10:112487422-112487444 CCTAATCTTGCATTTTTGAGAGG No data
1074329228_1074329237 21 Left 1074329228 10:112487378-112487400 CCTCCCAAAGTGCTGGGCTTACA 0: 671
1: 294302
2: 267052
3: 153508
4: 133798
Right 1074329237 10:112487422-112487444 CCTAATCTTGCATTTTTGAGAGG No data
1074329226_1074329237 27 Left 1074329226 10:112487372-112487394 CCTCAGCCTCCCAAAGTGCTGGG 0: 84188
1: 205795
2: 234195
3: 260821
4: 298692
Right 1074329237 10:112487422-112487444 CCTAATCTTGCATTTTTGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074329237 Original CRISPR CCTAATCTTGCATTTTTGAG AGG Intronic
No off target data available for this crispr