ID: 1074330179

View in Genome Browser
Species Human (GRCh38)
Location 10:112499109-112499131
Sequence GCATTTAATAAGTATATATA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074330173_1074330179 16 Left 1074330173 10:112499070-112499092 CCTGTACAAATATTTCAACATTA 0: 1
1: 0
2: 0
3: 45
4: 314
Right 1074330179 10:112499109-112499131 GCATTTAATAAGTATATATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074330179 Original CRISPR GCATTTAATAAGTATATATA AGG Intronic
No off target data available for this crispr