ID: 1074331230

View in Genome Browser
Species Human (GRCh38)
Location 10:112511706-112511728
Sequence TTGAATTAGGAGGAGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 978
Summary {0: 1, 1: 0, 2: 6, 3: 80, 4: 891}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074331230 Original CRISPR TTGAATTAGGAGGAGGAGGA GGG (reversed) Intronic
900030102 1:365016-365038 TGGAAAGAGGAGGAGGAGGACGG - Intergenic
900050754 1:594080-594102 TGGAAAGAGGAGGAGGAGGACGG - Intergenic
901305163 1:8227477-8227499 ATGAAGTAGGTGGAGGAAGATGG + Intergenic
901421546 1:9154538-9154560 CTGACTCAGGAGGAAGAGGAAGG - Intergenic
902165799 1:14570384-14570406 AGGAATTGGGAGGAGGAGGAGGG - Intergenic
902801553 1:18833137-18833159 TTGCCTTGGGAGGTGGAGGAAGG - Intergenic
903380833 1:22895957-22895979 AGGACTTAGGAGGAGGAGGGGGG + Intronic
903389922 1:22956389-22956411 GAGAAAGAGGAGGAGGAGGAAGG + Intronic
903549919 1:24150688-24150710 CAGCAGTAGGAGGAGGAGGAGGG + Intergenic
903947458 1:26972656-26972678 CAGAAATGGGAGGAGGAGGATGG + Intergenic
904016880 1:27428521-27428543 TTGAAGCAGGTGGAGGGGGAGGG + Intronic
904037482 1:27566679-27566701 GTGGAGGAGGAGGAGGAGGAGGG + Intronic
904087181 1:27917090-27917112 AAGAAGCAGGAGGAGGAGGAGGG - Intergenic
904626089 1:31803816-31803838 GAGAAGAAGGAGGAGGAGGAGGG + Intronic
904829342 1:33296623-33296645 TTGGATGAGGAGGAGAAAGAGGG + Intronic
905683552 1:39892152-39892174 TTGAAATAGGCAGCGGAGGAGGG - Intergenic
905950710 1:41948280-41948302 TAGAATTAGGAGAAGGAAAAAGG + Intronic
905961962 1:42050472-42050494 TTGTTTTTGGAGGAGGAGGGAGG - Intergenic
906502259 1:46349883-46349905 TTGAACTAGGAGGAGGAAGAAGG + Intronic
906518469 1:46453369-46453391 CTGCATTTGGAGGAGGATGAGGG - Intergenic
906542922 1:46602034-46602056 TTGAAAGATGAGGAGGAGGAGGG + Intronic
906583737 1:46957656-46957678 TAGAATTAGGAGAAGGAAAAAGG + Intergenic
907037487 1:51229240-51229262 TAGAATTAGGAGAAGGAAAAAGG + Intergenic
907473446 1:54689615-54689637 TTGGGTTTGAAGGAGGAGGAGGG + Intronic
907488078 1:54790841-54790863 AAGAAGGAGGAGGAGGAGGACGG - Intronic
907665857 1:56433334-56433356 CTGAAGTAGGAAGATGAGGAAGG - Intergenic
907758853 1:57337968-57337990 AAGAAGGAGGAGGAGGAGGAGGG - Intronic
908053145 1:60255018-60255040 TTGAACTGGGAGAAGGAAGAGGG - Intergenic
908562293 1:65318915-65318937 TTGATTTAGGAGGAAGGGGAGGG + Intronic
908698155 1:66868509-66868531 TAGAATTAGAAGGTGGAGGAAGG + Intronic
908840683 1:68277194-68277216 TTGAAATTGGTGGAGAAGGATGG + Intergenic
909142555 1:71887229-71887251 TAGGCTGAGGAGGAGGAGGAAGG + Intronic
909748427 1:79128274-79128296 TCGAGTTAGGAGGAGGGGGATGG - Intergenic
909845781 1:80393069-80393091 TTCAGGTAGGAGGAGAAGGATGG - Intergenic
910007902 1:82422289-82422311 GTGAAGTAGGAGGAGGAAGAAGG + Intergenic
910030471 1:82715444-82715466 TAGAAGTAGGAAGAGGAAGAAGG + Intergenic
910804815 1:91179889-91179911 TAGAATTAGGAGAAGGAAAAAGG + Intergenic
911023603 1:93413286-93413308 TTGAATTTGGGGGAGGGGGTTGG + Intergenic
911392075 1:97258109-97258131 ATGGATTAGGAGGGAGAGGAAGG + Intronic
911718464 1:101163199-101163221 TTGTTTTAGGAAGAGGGGGATGG + Intergenic
911740087 1:101377631-101377653 TGGAATTAGGAGGAAGTGGTTGG + Intergenic
911768839 1:101713310-101713332 ATGAATTAGAAGCAGGAGGAAGG - Intergenic
911906907 1:103581080-103581102 TTTAATTAGGAGAGGGAGCAAGG - Intergenic
912454297 1:109787499-109787521 TTTGTCTAGGAGGAGGAGGAGGG - Intergenic
912993435 1:114510928-114510950 GTGGAGGAGGAGGAGGAGGAAGG - Exonic
913046779 1:115080393-115080415 TTGTAGTGGGAGGAGGAGGTGGG - Intronic
913245905 1:116869735-116869757 GAGAAGGAGGAGGAGGAGGAGGG + Intergenic
913412024 1:118562607-118562629 ATGAATAAGGGGGAGGGGGAAGG + Intergenic
913432378 1:118809311-118809333 AGGAAGTAGGAGGAGGTGGAGGG + Intergenic
913466644 1:119149780-119149802 TTGAATTGGAAAGAGGAGCAGGG + Intergenic
914058053 1:144183179-144183201 AAGAAGGAGGAGGAGGAGGAGGG - Intergenic
914121092 1:144783186-144783208 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
915035307 1:152918726-152918748 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
915246392 1:154558756-154558778 TAGGAGGAGGAGGAGGAGGAGGG - Intronic
915271374 1:154756065-154756087 AAGAAGAAGGAGGAGGAGGAGGG + Intronic
915824779 1:159063868-159063890 TAGACTGAGGAGGAAGAGGAGGG - Intronic
916024734 1:160823819-160823841 TAGACATGGGAGGAGGAGGAAGG - Intronic
916456273 1:164973922-164973944 TTGCATTAGGAGAAAGAGCATGG + Intergenic
916874907 1:168958790-168958812 TTGAGATAGGGGAAGGAGGAGGG - Intergenic
917000327 1:170350828-170350850 ATTAAAAAGGAGGAGGAGGAGGG + Intergenic
917156142 1:172001043-172001065 TTGATTTAGGAGAATGAGGATGG + Intronic
918063175 1:181079743-181079765 TTAGAATAGGAGGAGGGGGAAGG + Intergenic
918245087 1:182652037-182652059 GTGAATGAGGAGGAGAATGAGGG + Intronic
918670104 1:187204207-187204229 CTGAATTGGGAGGAGGAGAATGG - Intergenic
918832710 1:189418604-189418626 ATGAATTTAGAGGAGGAGGTTGG - Intergenic
918910308 1:190559310-190559332 TTGGTTTTGGAGAAGGAGGATGG - Intergenic
919449334 1:197751867-197751889 AAGAAGGAGGAGGAGGAGGAGGG + Intronic
919449350 1:197751936-197751958 AAGAAGGAGGAGGAGGAGGAAGG + Intronic
919491042 1:198205043-198205065 TGGAAGTAGGAGAAGAAGGAAGG - Intronic
920034663 1:203058195-203058217 CTGGCTGAGGAGGAGGAGGAGGG + Intronic
920145102 1:203853553-203853575 TATAATCAGGAGGAAGAGGAAGG + Exonic
920199760 1:204252338-204252360 TGGGATGAGGAGGAAGAGGAAGG + Intronic
920382670 1:205544601-205544623 TTGAATTAGGATGAGGAAGAGGG - Intergenic
920511329 1:206554544-206554566 TGGACTTAGGAAGAGGAGGCTGG - Intronic
920523888 1:206651177-206651199 ATGAATAAAGAAGAGGAGGATGG - Intronic
920910933 1:210215683-210215705 TAGAGTAGGGAGGAGGAGGAGGG + Intergenic
920974045 1:210769001-210769023 TGGAATTAGGAGTCGGGGGAGGG - Intronic
921007621 1:211110777-211110799 TTATATTAGGAGGAGGGGTAGGG + Intronic
921350710 1:214231501-214231523 ATTAATTAGGAGAAGGAGCAGGG - Intergenic
921396866 1:214677825-214677847 AAGAAGGAGGAGGAGGAGGAAGG - Intergenic
921820198 1:219608452-219608474 TATAATCAGGAGGAAGAGGAAGG - Intergenic
922780725 1:228250351-228250373 TGGAAATGGGAGCAGGAGGATGG - Intronic
923109596 1:230880032-230880054 TTGATTGAGGAGGGGGAGGCTGG - Intergenic
923131529 1:231078844-231078866 TTAAAGAAGGAGGAGGAGGTCGG - Intergenic
923321170 1:232834993-232835015 TGGGATGAGGAGGAGGATGATGG - Intergenic
923517732 1:234711607-234711629 GGGAAGAAGGAGGAGGAGGATGG - Intergenic
923766913 1:236901052-236901074 GAGAATCTGGAGGAGGAGGAGGG + Exonic
924508033 1:244704432-244704454 TTGAAATAGGAGCGGGGGGAAGG + Intronic
924602633 1:245504753-245504775 TTTAACTAAGAGGAGAAGGAAGG - Intronic
924608669 1:245556299-245556321 AAGAAGAAGGAGGAGGAGGAGGG - Intronic
924608680 1:245556345-245556367 AAGAAGGAGGAGGAGGAGGAGGG - Intronic
924907630 1:248473493-248473515 GTGGATGAGGAGGATGAGGAGGG - Exonic
924916479 1:248574593-248574615 GTGGATGAGGAGGATGAGGAGGG + Exonic
1062961602 10:1576798-1576820 TTGAAGGTGGAGGATGAGGAGGG + Intronic
1063068278 10:2632331-2632353 TTGACTTATGAAGAGGAGCATGG - Intergenic
1063085700 10:2815867-2815889 TTGAAATAGGGGGGTGAGGAAGG - Intergenic
1063159443 10:3408707-3408729 GAGGATGAGGAGGAGGAGGAGGG + Intergenic
1063159481 10:3408849-3408871 GAGGATGAGGAGGAGGAGGAGGG + Intergenic
1063219298 10:3951134-3951156 TTGAACTCGGTGGTGGAGGAGGG - Intergenic
1063245746 10:4216450-4216472 TTGACTTAGGAAGGGGAAGAAGG + Intergenic
1063277314 10:4584345-4584367 GTGATTTAGGAGGACGAGGTTGG - Intergenic
1063376282 10:5556521-5556543 TTGAATTTGGAGGGGGAGGCAGG - Intergenic
1063603613 10:7504763-7504785 TTGGATTAGGAGTAGCAGGGGGG + Intergenic
1063621037 10:7649314-7649336 AAGAAGAAGGAGGAGGAGGAGGG - Intronic
1063961040 10:11305547-11305569 TGGGATTAGGAAGAGAAGGAAGG + Intronic
1065357684 10:24858517-24858539 TTGAATTAGATGGATGGGGAAGG - Intronic
1065500860 10:26381097-26381119 GTGAAAGAGGAGGAGGAGGGAGG - Intergenic
1065667871 10:28082456-28082478 AAGAAGGAGGAGGAGGAGGAAGG - Intronic
1067665062 10:48270697-48270719 TTGAAAGAGGAGGAGGTGGGGGG - Intronic
1067748243 10:48952664-48952686 CTGCATTAGGAGGAGGAGGGTGG - Intronic
1068987803 10:63123211-63123233 TTGTATTTTGGGGAGGAGGATGG - Intergenic
1069061481 10:63899344-63899366 TTGGGGTAGGAGGAGGAGGAGGG - Intergenic
1069458619 10:68573634-68573656 TTGGATTTGGAGGAACAGGAAGG - Exonic
1069668738 10:70183598-70183620 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
1070326106 10:75390333-75390355 GTGAAGGAGGAGGAAGAGGAGGG - Intergenic
1070644451 10:78191990-78192012 TGGAAGTGGGAGAAGGAGGAAGG + Intergenic
1071326908 10:84527030-84527052 TAGAATTAGGAGAAGGAAAAAGG - Intergenic
1071827790 10:89342429-89342451 TTGTTTAAGGAGCAGGAGGATGG - Intronic
1072251777 10:93587371-93587393 CTGGATCAGGATGAGGAGGATGG - Exonic
1072684056 10:97527088-97527110 TTGAACCAGGAGGCGGAGGTTGG + Intronic
1072778648 10:98227339-98227361 TTTTATTGGGAGAAGGAGGAAGG - Intronic
1073017949 10:100417029-100417051 TTGATTAAGGTGGCGGAGGACGG + Intergenic
1073420686 10:103421499-103421521 CTGATTCAGGAGGAGGAGGCTGG - Exonic
1074051906 10:109887961-109887983 TTGGATTCGGAGGACGAGGCTGG + Intronic
1074331230 10:112511706-112511728 TTGAATTAGGAGGAGGAGGAGGG - Intronic
1074691141 10:116005100-116005122 GAGAAAGAGGAGGAGGAGGAAGG - Intergenic
1074773772 10:116751071-116751093 AGGAAGAAGGAGGAGGAGGAGGG + Intergenic
1075005974 10:118830406-118830428 GTGGATTAGGAGGAGCTGGAGGG - Intergenic
1075070298 10:119315872-119315894 ATGAATTTGGAGGGGGAGGAAGG - Intronic
1075075876 10:119349787-119349809 TTGAGGAAGGAAGAGGAGGAAGG + Intronic
1075106942 10:119545693-119545715 TTGACTTAGGAGGCTAAGGAGGG - Intergenic
1075301719 10:121330659-121330681 AAGAAGGAGGAGGAGGAGGAAGG - Intergenic
1075337208 10:121617153-121617175 TTGGAAAAGGAGAAGGAGGAAGG + Intergenic
1075432639 10:122401429-122401451 TGGCAATAGGAGAAGGAGGAAGG + Intronic
1075866451 10:125725108-125725130 CTGGCTTAGGAGGAGGAAGACGG + Intronic
1076050552 10:127329758-127329780 TTGAAATAGGTGGACGAGGCAGG + Intronic
1077210773 11:1370091-1370113 GGGAAGGAGGAGGAGGAGGAGGG + Intergenic
1077230168 11:1455154-1455176 TTGGGTTAGGAGGAGCAGAAAGG + Intronic
1077924437 11:6666746-6666768 GAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1078502600 11:11896387-11896409 AGGAATTGGGAGGAGGAGGACGG + Intronic
1078593199 11:12663732-12663754 CTGATTTAGGAGGAAGAGAAGGG - Intergenic
1078660416 11:13281215-13281237 TTGACTTAGGAGAGGAAGGATGG + Intronic
1078836140 11:15031877-15031899 TAGGCTGAGGAGGAGGAGGAAGG - Intronic
1079445572 11:20553706-20553728 AGGAAGGAGGAGGAGGAGGAGGG - Intergenic
1079445578 11:20553722-20553744 CTCAAGGAGGAGGAGGAGGAAGG - Intergenic
1079623940 11:22592851-22592873 AAGAAGGAGGAGGAGGAGGAAGG - Intergenic
1079848083 11:25495545-25495567 TTGAATTAGGTGCAGCATGAAGG - Intergenic
1079887259 11:26003793-26003815 TAGAATTAGGAGAAGGAAAAAGG + Intergenic
1079933624 11:26593244-26593266 TTGAATTAGGAGAAGGAAAAAGG - Intronic
1080073335 11:28115724-28115746 TAGACTGAGGAAGAGGAGGAGGG + Intronic
1080727014 11:34908532-34908554 TTGACTGATGAGGAGGAGGAGGG - Intronic
1080933551 11:36838393-36838415 ATCATTTAGGAGGAGGTGGAGGG + Intergenic
1082877952 11:58007289-58007311 TTGAATATGGAGGTGGAGTAGGG + Intergenic
1083374453 11:62208323-62208345 TAGAAGGAGGAGGAGGAAGAAGG + Intergenic
1083494216 11:63036107-63036129 TTAAAATAGGAGGGGGAGGGAGG + Intergenic
1083573431 11:63772133-63772155 GAGAAGGAGGAGGAGGAGGAGGG + Intergenic
1083788890 11:64971473-64971495 GGGAAGGAGGAGGAGGAGGAGGG + Intronic
1084177082 11:67428564-67428586 TTGGATTTGGAGACGGAGGAAGG + Exonic
1084234803 11:67780364-67780386 TGGCATTAGGATGAAGAGGAAGG - Intergenic
1084931452 11:72559815-72559837 TGGAGTTAGGAGGCTGAGGAGGG + Intergenic
1084932959 11:72571400-72571422 TGGAGTTTGGATGAGGAGGACGG - Intergenic
1085189023 11:74601674-74601696 TTTACTTAGGAGGCTGAGGAAGG + Intronic
1085431543 11:76454918-76454940 CAGTATTAGGAGGGGGAGGAGGG - Intronic
1085601444 11:77859523-77859545 TAGAATTAGGAGAAGGAAAAAGG - Intronic
1085967959 11:81551952-81551974 TTTTATGAGGAAGAGGAGGAGGG - Intergenic
1086441659 11:86834798-86834820 TAGAATTAGGAGAAGGAAAAAGG - Intronic
1087496451 11:98896022-98896044 GAAAATTTGGAGGAGGAGGAAGG + Intergenic
1088262951 11:107961411-107961433 TGGTATTAGGATTAGGAGGAGGG - Intronic
1088521767 11:110709675-110709697 TTGAAATATGAAGAGGAAGAAGG + Intronic
1088644095 11:111902552-111902574 TTGGATAAGGAGGATGAGAAAGG - Intergenic
1089042193 11:115462613-115462635 TTTGATGTGGAGGAGGAGGAGGG + Intronic
1089298394 11:117483183-117483205 TTGAGTTGGGCGGAGGAGAAAGG - Intronic
1089749996 11:120644607-120644629 ATGTCTCAGGAGGAGGAGGAAGG + Intronic
1089844054 11:121444610-121444632 TTAAATTATGAGGTGGAAGAGGG + Intergenic
1091337122 11:134780619-134780641 AAGAGTGAGGAGGAGGAGGAGGG - Intergenic
1091632810 12:2174956-2174978 TAGGAAGAGGAGGAGGAGGAGGG + Intronic
1091727837 12:2857940-2857962 TTGAATTTGGGGTGGGAGGATGG - Exonic
1091757380 12:3063057-3063079 TTGCATTAGGAGGATGAGAGGGG + Intergenic
1091882044 12:3987513-3987535 AAGAAGGAGGAGGAGGAGGAGGG + Intergenic
1091898997 12:4128268-4128290 TTAAATTAGTAGGATGAGGCTGG - Intergenic
1092164920 12:6336734-6336756 TTGAACTGGGAGGAGGAGCTGGG - Intronic
1092808438 12:12249491-12249513 TTGAATGAGGGGGAAGAGGAAGG - Intronic
1093084579 12:14852466-14852488 AAGAAGAAGGAGGAGGAGGAGGG - Intronic
1093348671 12:18070447-18070469 TAGAATTAGGAGAAGGAAAAAGG + Intergenic
1093457072 12:19374985-19375007 GAGAAGGAGGAGGAGGAGGAAGG + Intronic
1094129893 12:27063500-27063522 AAGAAGAAGGAGGAGGAGGAAGG - Intronic
1094244430 12:28272600-28272622 ATGAATAAAGAGAAGGAGGAAGG - Intronic
1094609166 12:31976773-31976795 CTTAACTAGGCGGAGGAGGAGGG + Intronic
1094806779 12:34101709-34101731 TAGAATTAGGAGAAGGAAAAAGG + Intergenic
1095381062 12:41592663-41592685 TTGAAGTAGAAGTAGGAGTAGGG + Intergenic
1095610009 12:44116775-44116797 TAGAATTTGTAGGATGAGGATGG - Intronic
1096017952 12:48295672-48295694 AAGAAGGAGGAGGAGGAGGAGGG + Intergenic
1096156577 12:49344823-49344845 CTGGAGTAGGAGAAGGAGGAGGG + Intergenic
1096351752 12:50906452-50906474 TAGAATTAGGAGAAGGAAAAAGG - Intergenic
1096524221 12:52201034-52201056 TTGGAGGAGGAGGAGGAGGAGGG - Intergenic
1096710505 12:53452221-53452243 GTGGAGGAGGAGGAGGAGGAAGG - Exonic
1096933335 12:55241307-55241329 TAGAATTTGGAGGTGGAGCAGGG + Intergenic
1097823099 12:64147361-64147383 AGGAATTGGGAGGAGGAGGTGGG - Exonic
1097938381 12:65278487-65278509 GAGAAGGAGGAGGAGGAGGACGG + Intergenic
1097982299 12:65746844-65746866 TTGAATGAAGAGGAGAAAGAAGG + Intergenic
1098106035 12:67069517-67069539 AGGAAGAAGGAGGAGGAGGAGGG - Intergenic
1098504854 12:71237612-71237634 TAGAAAAAAGAGGAGGAGGAGGG - Intronic
1098936601 12:76486940-76486962 ATAAAATAAGAGGAGGAGGATGG + Intronic
1099133213 12:78862802-78862824 AAGAAGTTGGAGGAGGAGGAAGG - Intergenic
1099585765 12:84510363-84510385 TTGAAATAGGAGAAAGAAGAGGG - Intergenic
1099827569 12:87797757-87797779 TTGAATTAGGATTCGGAGGTAGG + Intergenic
1099924726 12:89003488-89003510 TAGAATTTGGGGGAGGAGGGTGG + Intergenic
1100610557 12:96188615-96188637 TTTACTTGGGAGGTGGAGGAGGG + Intergenic
1100935634 12:99661899-99661921 TTCAATCAGCAGGAAGAGGAAGG - Intronic
1101699019 12:107154181-107154203 TTGAATGTGGAGAATGAGGATGG - Intergenic
1101800929 12:108021499-108021521 ATGAAGGAGCAGGAGGAGGAAGG - Intergenic
1101997367 12:109534666-109534688 TTGAAGCAGGTGGAGGAGGTGGG - Exonic
1102167892 12:110820835-110820857 ACGAAGAAGGAGGAGGAGGAGGG - Intergenic
1102749148 12:115277179-115277201 GAGAAGGAGGAGGAGGAGGAGGG + Intergenic
1102899329 12:116624143-116624165 AAGAAGGAGGAGGAGGAGGAGGG + Intergenic
1103525150 12:121562646-121562668 ATGGAGGAGGAGGAGGAGGAAGG + Intronic
1104275659 12:127325035-127325057 ATGAAGATGGAGGAGGAGGAAGG - Intergenic
1104820278 12:131673061-131673083 ATGAAGGAGGAGGAGGAGGAGGG + Intergenic
1104851169 12:131874865-131874887 TAGAATTAGGAGAAGGAAAAAGG - Intergenic
1104954337 12:132457137-132457159 TCGAATGGGGAGGAGGAGGCAGG + Intergenic
1105538010 13:21287813-21287835 TTGAATAAGGAGGAGCAGCGAGG - Intergenic
1105717527 13:23082093-23082115 TTGCCTGAGGAGGAGGAAGAAGG - Intergenic
1105935919 13:25099034-25099056 TTATATTGGGAGGAGGAGGAGGG - Exonic
1106784897 13:33096901-33096923 TAGACTGAGGAGGAGGAGGAGGG + Intergenic
1107111252 13:36700399-36700421 TTGAAACGGGAGGAGGAGGGAGG - Intergenic
1107480122 13:40779309-40779331 TTGAAGCAGGAGGAGGAGTTAGG - Intergenic
1107618018 13:42192558-42192580 AAGAAGGAGGAGGAGGAGGAAGG - Intronic
1108372938 13:49788942-49788964 TTGAAGGAGGAGGAAGAGGGAGG + Intronic
1108437938 13:50419702-50419724 TTACAGCAGGAGGAGGAGGAGGG + Intronic
1108596193 13:51951692-51951714 GGGGATGAGGAGGAGGAGGAGGG + Intronic
1108598699 13:51972342-51972364 AAGAATTAGAGGGAGGAGGAGGG - Intronic
1108623078 13:52202892-52202914 TTGAAGTAGGAGTAGGAGTTAGG - Intergenic
1108663647 13:52608150-52608172 TTGAAGTAGGAGTAGGAGTTAGG + Intergenic
1109118333 13:58419709-58419731 TTGATTTAGTTGGAGGAAGAAGG - Intergenic
1110073731 13:71212040-71212062 AGAAATTAGGAGGAGGAGGCAGG - Intergenic
1110429047 13:75402021-75402043 TTGCATTAGATGCAGGAGGAAGG - Intronic
1110504290 13:76267492-76267514 TAGAAGGAGAAGGAGGAGGAAGG + Intergenic
1110975479 13:81828564-81828586 GGGAAGGAGGAGGAGGAGGAGGG + Intergenic
1111362787 13:87197081-87197103 AAGAAGGAGGAGGAGGAGGAAGG + Intergenic
1111477489 13:88771515-88771537 TTGAAGTAGAAGGAAGAGAAGGG - Intergenic
1112406965 13:99129818-99129840 TGGGCTGAGGAGGAGGAGGAAGG + Intergenic
1112484754 13:99810360-99810382 TTGAACTAGGAGCTGAAGGATGG + Intronic
1113141842 13:107161261-107161283 TTGAAGGAGGAAGATGAGGAGGG + Intergenic
1113670902 13:112175475-112175497 CAGAATCTGGAGGAGGAGGAAGG + Intergenic
1114210674 14:20611545-20611567 GTGAGTGAGAAGGAGGAGGAGGG + Intergenic
1114316465 14:21514355-21514377 GAGAAGGAGGAGGAGGAGGAGGG + Intergenic
1114553471 14:23547765-23547787 TTGAATTAGTAGGGAGAGGCTGG - Intronic
1115283647 14:31693427-31693449 TTGGATGAGGTGGATGAGGATGG - Intronic
1115655451 14:35439290-35439312 TTGAATGAGGAAAGGGAGGAGGG - Intergenic
1115659133 14:35474601-35474623 AAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1116412432 14:44640835-44640857 TTGTATGTGAAGGAGGAGGAAGG + Intergenic
1116447128 14:45023008-45023030 TAGAATTAGGAGAAGGAAAAGGG - Intronic
1117229799 14:53705107-53705129 TTAAATAAGAAGGAGGGGGAGGG + Intergenic
1117309668 14:54509418-54509440 GTGGAGGAGGAGGAGGAGGAGGG - Intergenic
1117372761 14:55093967-55093989 AGGAAGAAGGAGGAGGAGGAGGG + Intergenic
1117486633 14:56204454-56204476 GTGAATTTGGAGGAGGACCATGG + Intronic
1118411129 14:65479565-65479587 TGGAAGTAGGAGAAGGAGAAAGG - Intronic
1119067410 14:71542665-71542687 AGGAAGGAGGAGGAGGAGGAGGG - Intronic
1119610929 14:76061429-76061451 TGGAATTAGAAGGAGTGGGAGGG - Intronic
1120059337 14:79963773-79963795 TTGGATTTGGAGGAGGAGGAGGG - Intergenic
1120864245 14:89282154-89282176 ATGATTGAGGAGGAGTAGGAGGG + Intronic
1120899897 14:89566826-89566848 GTGGAGGAGGAGGAGGAGGAAGG - Intronic
1120969682 14:90197024-90197046 TAGAATTAGGAGGAGAAAGAGGG - Intergenic
1121085011 14:91139251-91139273 GAGAACAAGGAGGAGGAGGAAGG - Intronic
1121735707 14:96216675-96216697 AAGAAGGAGGAGGAGGAGGAAGG + Intronic
1121735723 14:96216730-96216752 AGGAAGGAGGAGGAGGAGGAAGG + Intronic
1121808596 14:96857252-96857274 TAGAATTAGGGGGATGGGGATGG + Intronic
1121905201 14:97734800-97734822 TGGAAGAAGGAGGAGGAAGAAGG - Intergenic
1122410086 14:101521400-101521422 TAGAATCAGGAGGTGGGGGAGGG + Intergenic
1122943839 14:104996030-104996052 TTGGAGTGGGAGGAGCAGGATGG - Intronic
1123991601 15:25687618-25687640 CTGAATGAGGCGAAGGAGGATGG - Intronic
1124180807 15:27471746-27471768 TTAAATTAGTAGGAGGAAGAAGG - Intronic
1124416338 15:29475652-29475674 AGAAATGAGGAGGAGGAGGAAGG + Intronic
1124459631 15:29877610-29877632 AAGAAGAAGGAGGAGGAGGAGGG - Intronic
1124679234 15:31715416-31715438 TTGAACTAAAAGGAGGGGGAAGG - Intronic
1124696577 15:31869352-31869374 CTGGAGGAGGAGGAGGAGGATGG + Intronic
1124710787 15:32008347-32008369 AAGAAATAGGAGGAGGAGAAGGG - Intergenic
1125024817 15:35019525-35019547 GAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1125142118 15:36420441-36420463 TAGAATTAGGATGAGGGTGAGGG - Intergenic
1125511222 15:40293449-40293471 TGGGAAGAGGAGGAGGAGGAAGG + Intronic
1126504998 15:49394756-49394778 GTGAGTTAGGAGCAGTAGGAAGG + Intronic
1126650238 15:50912908-50912930 TTGATTTAGGAGGCTGAGGTGGG - Intronic
1126764161 15:51996690-51996712 AAGAAGAAGGAGGAGGAGGACGG - Intronic
1126881502 15:53103629-53103651 ATGAATGAGGAGGATGATGAAGG + Intergenic
1126950718 15:53877591-53877613 GAGAATAGGGAGGAGGAGGAGGG + Intergenic
1126963746 15:54027990-54028012 TTGAATTGGGAGGAAGTGGTAGG + Intronic
1127073963 15:55308388-55308410 TAGAATTAGGAGAAGGAAAAAGG - Intronic
1127210787 15:56772482-56772504 TTAAATAAAGAGCAGGAGGAAGG + Intronic
1128327981 15:66737520-66737542 TTGAATTGGAGGAAGGAGGAAGG + Intronic
1128582611 15:68819839-68819861 ATAAATTAGAAGGAGGGGGAGGG - Intronic
1128856135 15:71018045-71018067 CTGTAAAAGGAGGAGGAGGAGGG + Intronic
1130536147 15:84786389-84786411 ATGAGTTTGGAGGAGTAGGAGGG + Intronic
1130744361 15:86635262-86635284 GGGAAGGAGGAGGAGGAGGAGGG - Intronic
1131139823 15:89968109-89968131 GAGAAGAAGGAGGAGGAGGAGGG + Intergenic
1131386818 15:92014852-92014874 TTGAGGGAGGTGGAGGAGGAGGG + Intronic
1131621818 15:94075963-94075985 TTGCATTAGGAGGAGGAATGAGG - Intergenic
1131901065 15:97088523-97088545 AGGAAGGAGGAGGAGGAGGAAGG - Intergenic
1131901070 15:97088539-97088561 ATGAAGGAGGAGGAGGAGGAAGG - Intergenic
1131901083 15:97088587-97088609 AGGAAAGAGGAGGAGGAGGAAGG - Intergenic
1131901098 15:97088639-97088661 AGGAAGGAGGAGGAGGAGGAAGG - Intergenic
1131901103 15:97088655-97088677 AGGAAGGAGGAGGAGGAGGAAGG - Intergenic
1131901123 15:97088728-97088750 AAGAAGGAGGAGGAGGAGGAAGG - Intergenic
1132028049 15:98419586-98419608 ATGGAGGAGGAGGAGGAGGAGGG + Intergenic
1132053776 15:98633961-98633983 AAGAAGGAGGAGGAGGAGGAGGG - Intergenic
1132439302 15:101842643-101842665 TAAAATTAGGAAGAGGGGGAGGG - Intergenic
1132906749 16:2286425-2286447 TAGATTTAGGAGGAGAAGGCAGG + Intronic
1133093343 16:3422889-3422911 TTGAATGAGGAAAAGCAGGATGG - Intronic
1133392761 16:5422795-5422817 AAGAAAGAGGAGGAGGAGGAGGG + Intergenic
1134748052 16:16602967-16602989 AAGAAGGAGGAGGAGGAGGAAGG - Intergenic
1135224833 16:20646711-20646733 TAGAATTAGGAGAAGGAAAAAGG + Intronic
1135264509 16:21011233-21011255 TTGATTTTGAAGGATGAGGAAGG + Intronic
1135472562 16:22744447-22744469 TTTAAATAGGAGGTGGGGGAAGG + Intergenic
1135547988 16:23378558-23378580 TTGGATGAGGAGCAGGAGGAAGG - Intronic
1137556975 16:49477040-49477062 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
1137556991 16:49477122-49477144 AAGAAAAAGGAGGAGGAGGAGGG + Intergenic
1137616552 16:49851573-49851595 TTAACAGAGGAGGAGGAGGAGGG - Intronic
1137830311 16:51537921-51537943 CTGAATTAGAAGGAGGAGTCTGG - Intergenic
1137995653 16:53208360-53208382 CTGAATGAGTGGGAGGAGGAGGG + Intronic
1138088699 16:54156723-54156745 TGGATTTAGGAGGAGTGGGAGGG - Intergenic
1139277160 16:65738629-65738651 TTGAATTTGGAAGAGCAGGGAGG + Intergenic
1139750491 16:69106610-69106632 ATGAATTAGGAGGCGGACGCCGG + Intronic
1139972615 16:70785672-70785694 CTCAGTGAGGAGGAGGAGGAGGG + Intronic
1140185189 16:72763338-72763360 TTGAAGAAAGAAGAGGAGGAGGG + Intergenic
1140357047 16:74315377-74315399 TAGAATAGGGAGGAGGGGGAAGG - Intergenic
1140622231 16:76749117-76749139 TGGAATTTGGGAGAGGAGGATGG - Intergenic
1141007121 16:80363056-80363078 GAGAAGGAGGAGGAGGAGGAAGG + Intergenic
1141009808 16:80386999-80387021 CTGAATGACGTGGAGGAGGAGGG - Intergenic
1141530509 16:84643395-84643417 TGGGAGGAGGAGGAGGAGGAGGG - Intergenic
1141703599 16:85653236-85653258 TAGGAGGAGGAGGAGGAGGAGGG - Intronic
1142328117 16:89431636-89431658 TTGAGGGAGGAGGTGGAGGAAGG - Intronic
1203141786 16_KI270728v1_random:1771705-1771727 ATGATGGAGGAGGAGGAGGAGGG - Intergenic
1142529640 17:571211-571233 CTGAAGTAGGAGGAGGGGAAGGG + Intronic
1143193781 17:5059804-5059826 GAGAAGGAGGAGGAGGAGGAGGG - Intergenic
1143194405 17:5064546-5064568 TAAAATTTGGAGGAGGAGGCTGG - Intergenic
1143264202 17:5623561-5623583 TTGATTAGGGAGGAGGAGAACGG + Intergenic
1143479887 17:7222103-7222125 TGGAATTGGGCGGAGGAGAAGGG - Intronic
1143729078 17:8870166-8870188 TGGCAGAAGGAGGAGGAGGAAGG - Intergenic
1143772640 17:9178454-9178476 GAGAATTAGGAAGAGGAGGGAGG - Intronic
1143980488 17:10865258-10865280 TTGAATGTGAAGGAAGAGGATGG - Intergenic
1144968622 17:19093395-19093417 TTGCAGGAAGAGGAGGAGGAGGG + Intronic
1144979293 17:19158668-19158690 TTGCAGGAAGAGGAGGAGGAGGG - Exonic
1144988929 17:19219564-19219586 TTGCAGGAAGAGGAGGAGGAGGG + Intronic
1145964463 17:28906988-28907010 TGGTATTCTGAGGAGGAGGAGGG + Exonic
1146364516 17:32210688-32210710 CTGAGGGAGGAGGAGGAGGAGGG + Intronic
1146454576 17:32998923-32998945 CTGAATTAGGTGGAGGAGGATGG - Intergenic
1146639445 17:34528981-34529003 TTGAGTGATGAGGATGAGGATGG + Intergenic
1146736387 17:35242553-35242575 TCGAATTACTAGGAGAAGGAGGG + Intergenic
1146773950 17:35595640-35595662 TTTGATTGGGGGGAGGAGGAGGG + Intronic
1146997374 17:37333137-37333159 TAGAATTAGGAGCAGGAAAAAGG + Intronic
1147510706 17:41066537-41066559 TTGGATTGGAAGGATGAGGAGGG - Intergenic
1148070714 17:44907055-44907077 TTGCGTTAGAATGAGGAGGAAGG - Intronic
1148193795 17:45698895-45698917 AAGAATGAGGAGGAAGAGGAAGG + Intergenic
1148249594 17:46064625-46064647 TTGGAGAGGGAGGAGGAGGAGGG - Intronic
1148271460 17:46265401-46265423 TAGGAAGAGGAGGAGGAGGAAGG - Intergenic
1148513580 17:48194752-48194774 TTGAATTAAAAGGAAGAGGGAGG - Intronic
1149169176 17:53790295-53790317 TTAATTTAAGAGGAGGAAGAAGG - Intergenic
1149273760 17:55012643-55012665 TAGAATTAGGAGAAGGAAAAGGG - Intronic
1149696968 17:58623714-58623736 CACAAATAGGAGGAGGAGGAAGG + Intronic
1149723639 17:58870113-58870135 CTGGAGGAGGAGGAGGAGGAAGG + Intronic
1150890545 17:69144248-69144270 AGGAAGGAGGAGGAGGAGGAGGG - Intergenic
1151158791 17:72147189-72147211 AAGAAGGAGGAGGAGGAGGAGGG + Intergenic
1151223769 17:72633327-72633349 TTTAATAACAAGGAGGAGGAGGG + Intergenic
1151624373 17:75267533-75267555 TTGAGCAAGGAGGAGGAGGTGGG - Exonic
1152012219 17:77725612-77725634 CTGAAGTAGGAGAAGGAGGTTGG + Intergenic
1152188540 17:78874113-78874135 TGGAAGGAGGAGGAGGAGGCTGG - Intronic
1152949655 17:83221544-83221566 TGGAAAGAGGAGGAGGAGGACGG + Intergenic
1153185255 18:2478918-2478940 AGGAAGAAGGAGGAGGAGGAGGG + Intergenic
1153314732 18:3710794-3710816 TGGAGTTGGGAGGTGGAGGAAGG + Intronic
1153319135 18:3754290-3754312 TTGAAGTAGGAGGCTGAGTACGG - Intronic
1153934541 18:9909564-9909586 TTGGATTAGGGGGAGTAAGAGGG - Intergenic
1155066517 18:22273718-22273740 ATGGAGGAGGAGGAGGAGGAGGG - Intergenic
1156349683 18:36293017-36293039 TTCAAATTGGAGCAGGAGGATGG + Intergenic
1157241854 18:46018090-46018112 GTGAATTAAGAGGATGAGTAGGG - Intronic
1157382031 18:47227207-47227229 GTGGAGGAGGAGGAGGAGGAAGG - Intronic
1157385228 18:47254569-47254591 TGGAAGTAAGAGGAGGAGGCCGG + Intergenic
1157774777 18:50384047-50384069 TGGAATTATGAGTGGGAGGATGG - Intronic
1157977633 18:52343523-52343545 TTGATGTTGGGGGAGGAGGATGG + Intronic
1158239218 18:55358359-55358381 TAGTAGTATGAGGAGGAGGATGG + Intronic
1158400131 18:57114493-57114515 GTGAGTTATGAGGAGGAGTAGGG - Intergenic
1158713786 18:59860366-59860388 TAGAATTAGGAGGCCGAGCATGG + Intergenic
1159198706 18:65153785-65153807 AAGAAGGAGGAGGAGGAGGATGG - Intergenic
1159657770 18:71053012-71053034 ATGAAATAGGAGGAGGACGAAGG - Intergenic
1160062093 18:75540103-75540125 TTGAATCTGCAGAAGGAGGAAGG + Intergenic
1160345965 18:78131924-78131946 ATCAATTAAGAGGAAGAGGAAGG - Intergenic
1160480305 18:79233988-79234010 TAGGCTGAGGAGGAGGAGGAAGG + Intronic
1160819824 19:1052644-1052666 GAGAAGTAGGAGGAAGAGGAGGG + Intronic
1161509544 19:4662919-4662941 CTGGGGTAGGAGGAGGAGGAAGG - Intronic
1161635117 19:5383652-5383674 AAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1162318774 19:9958428-9958450 TTGAATTAGGAGTAAGATGTTGG - Intergenic
1163361856 19:16851741-16851763 TTTGAAAAGGAGGAGGAGGAAGG + Intronic
1163387259 19:17007459-17007481 AAGAAGAAGGAGGAGGAGGAGGG + Intronic
1163827864 19:19533606-19533628 GAGAATGGGGAGGAGGAGGATGG - Intronic
1163900945 19:20099770-20099792 TAGAATTAGGAGAAGGAAAAAGG + Intronic
1164795836 19:31027760-31027782 TTGGATTAGGAAGTGGGGGAGGG + Intergenic
1165273102 19:34727055-34727077 TAACAATAGGAGGAGGAGGAGGG - Intergenic
1165690887 19:37862382-37862404 AAGAAGGAGGAGGAGGAGGAAGG + Intergenic
1165714514 19:38035772-38035794 GATAATGAGGAGGAGGAGGATGG + Intronic
1165751483 19:38263230-38263252 TTGAATGGGGTGGCGGAGGAAGG - Intronic
1166085634 19:40472812-40472834 TGGGATGAGGAGGAGGGGGAAGG + Intronic
1166226881 19:41401480-41401502 TTGGATTAGAAGGAGGAGTGGGG + Intronic
1166343085 19:42150342-42150364 ATGGATGAGGAGGAAGAGGAGGG + Intronic
1166567932 19:43776447-43776469 TCAGATCAGGAGGAGGAGGAGGG + Intronic
1167139051 19:47636976-47636998 TTGACTAAGGAGGGGAAGGAGGG - Intronic
1167144321 19:47672835-47672857 CTGAATGATGAGGATGAGGATGG - Intronic
1167153919 19:47726554-47726576 GAGAAGAAGGAGGAGGAGGAGGG - Intronic
1167189961 19:47979169-47979191 ATGGAAGAGGAGGAGGAGGAGGG - Intronic
1167191288 19:47991750-47991772 GTGAAGAAGGAAGAGGAGGAGGG - Intronic
1167295557 19:48646893-48646915 GTGAAGGAGGAGGGGGAGGAGGG + Intergenic
1167885348 19:52495336-52495358 TTGGATTAGGAGGCCGAGGCAGG + Intronic
1167890913 19:52538514-52538536 TTGGATTAGGAGGCCGAGGCAGG + Intronic
1167913460 19:52721874-52721896 TTGGATTAGGAGGCTGAGGCAGG - Intronic
1168107021 19:54171975-54171997 CTGGAGGAGGAGGAGGAGGATGG - Exonic
1168135798 19:54350506-54350528 TCCAAATAGGAGAAGGAGGAGGG + Intergenic
925496218 2:4452473-4452495 GAGAAGGAGGAGGAGGAGGAGGG - Intergenic
925508471 2:4597081-4597103 AAGAAAAAGGAGGAGGAGGAAGG + Intergenic
926316775 2:11715802-11715824 ATGAAAATGGAGGAGGAGGATGG + Intronic
926418151 2:12671144-12671166 CTGAATCAGGAGTGGGAGGATGG - Intergenic
926580016 2:14624811-14624833 TTAAGTAAGGAGGAGGAGGTAGG + Intergenic
926867515 2:17375945-17375967 TATATTTTGGAGGAGGAGGAAGG - Intergenic
927016588 2:18969709-18969731 TTGAATTGGGAGGGAGAAGAAGG + Intergenic
928266138 2:29813423-29813445 TGGATGGAGGAGGAGGAGGAGGG + Intronic
928314988 2:30238025-30238047 TTGAATTAGGGTAAGGAAGAAGG - Intronic
928476556 2:31632828-31632850 TAGAATTAGGAGAAGGAAAAAGG + Intergenic
928677414 2:33663225-33663247 TAGAATTAGGAGAAGGAAAAAGG + Intergenic
929776299 2:44933055-44933077 TTGAGGTAGGAGCTGGAGGAGGG - Intergenic
930364680 2:50424289-50424311 AAGAAGAAGGAGGAGGAGGAGGG + Intronic
930631649 2:53760177-53760199 TAGAATTAGGAGAAGGAAAAAGG + Intronic
930774246 2:55157128-55157150 TTCAATTAGGAAGGGAAGGAAGG + Intergenic
931138812 2:59434503-59434525 TTGAATGAAGAAGAAGAGGAAGG + Intergenic
932289736 2:70566730-70566752 TAGAATTAAAAGGTGGAGGAAGG + Intergenic
932669926 2:73728505-73728527 GTGAATGTGGAGGAGGAAGACGG + Intergenic
932722797 2:74150083-74150105 TTAAATTATGGGGAAGAGGAAGG - Intergenic
932993133 2:76812794-76812816 AAGAATAAGGAGGAGGAGGGGGG - Intronic
933174929 2:79164399-79164421 TAGAATTAGGAGAAGGAAAAAGG - Intergenic
933197385 2:79407605-79407627 AAGAAGGAGGAGGAGGAGGAGGG + Intronic
933374480 2:81461905-81461927 TGGAGTTAGGAGGATTAGGAGGG - Intergenic
933505830 2:83176129-83176151 TTGGATAAGGAGGAGGAAGAGGG - Intergenic
934535320 2:95128581-95128603 GAGGATGAGGAGGAGGAGGAGGG + Intronic
936087717 2:109480625-109480647 TGGGAGGAGGAGGAGGAGGATGG + Intronic
936387197 2:112041035-112041057 TAGAATTAGGAGAAGGAAAATGG - Intergenic
936388368 2:112050880-112050902 TCTAAGAAGGAGGAGGAGGAAGG - Intergenic
936608370 2:113979194-113979216 TTCAACTAGGAGGAGGAGGTTGG + Intergenic
938736594 2:134191669-134191691 GAGAAAGAGGAGGAGGAGGAGGG - Intronic
938999388 2:136716387-136716409 TAGAGTGAGGAGGATGAGGAGGG + Intergenic
939674814 2:145059574-145059596 TTGAATTAAGCAGTGGAGGAAGG + Intergenic
939966951 2:148619639-148619661 GGGAAAAAGGAGGAGGAGGAGGG - Intergenic
940216128 2:151305390-151305412 AAGAAAAAGGAGGAGGAGGAGGG + Intergenic
940253720 2:151707508-151707530 TACAAGTAGGAGGAGGAGGATGG + Intronic
940987383 2:160062669-160062691 TTGGGGAAGGAGGAGGAGGAGGG + Intergenic
941045219 2:160667416-160667438 TTGGAATAGTAGGAGGATGAGGG + Intergenic
941279558 2:163533232-163533254 TTGAAATAAGAGGAGAGGGAGGG + Intergenic
941311098 2:163932968-163932990 TTGAATTAGTAGGATCAGAAAGG - Intergenic
941675199 2:168336885-168336907 TGGAGTGAGGAGGAGGAGGGAGG - Intergenic
941776259 2:169396673-169396695 TGGAAGGAGGAGGAGGAGAAGGG + Intergenic
942058367 2:172205959-172205981 CTGAATTAAGAGGAGAAGGAAGG + Intergenic
942199454 2:173556371-173556393 TGCAAACAGGAGGAGGAGGAAGG - Intergenic
942210424 2:173664232-173664254 TTGAAGAAGGCGGAGGAGGAGGG - Intergenic
942241134 2:173964753-173964775 GGGAAAGAGGAGGAGGAGGAGGG - Intronic
942306393 2:174611499-174611521 TGGTATCAGGAGGAGGAGGAGGG + Intronic
942496027 2:176541046-176541068 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
942580321 2:177410469-177410491 TAGAATTAGGAGAAGGAAAAAGG - Intronic
942789924 2:179749367-179749389 TGGAGTTTGGAGGAGGTGGAAGG - Intronic
942800729 2:179872586-179872608 GAGAAGGAGGAGGAGGAGGAGGG + Intergenic
942816596 2:180060106-180060128 TAGAATTAGGAGAAGGAAAAAGG + Intergenic
942877032 2:180812957-180812979 TTTACTTAGGAGGCGGAGGCAGG + Intergenic
942890757 2:180984070-180984092 TGCAATTAGGAGGAGGATCAAGG - Exonic
943188135 2:184640183-184640205 AAGAAGTAGGAGGAGGAGCAGGG + Intronic
943989826 2:194673825-194673847 TTGAATTATGAAGAGAAGGATGG + Intergenic
944039237 2:195335876-195335898 TAGAATTAGGAGAAGGAAAAAGG - Intergenic
944205448 2:197153283-197153305 AAGAAGGAGGAGGAGGAGGAGGG + Intronic
944936279 2:204572302-204572324 TTGAAGGAGGAGGAAAAGGAGGG + Intronic
945033633 2:205686218-205686240 TAGGAGGAGGAGGAGGAGGAGGG - Intronic
945268717 2:207917116-207917138 TTGAAGTAGAATGAGGAGAATGG + Intronic
946175561 2:217920067-217920089 GACAATTAGGTGGAGGAGGAGGG - Intronic
946339721 2:219059588-219059610 TTGAATCGGGAGGCGGAGGTGGG - Intronic
946441056 2:219696391-219696413 TTGATCTAGGAAGAGGAGGCAGG - Intergenic
946458067 2:219845259-219845281 TTGAGGCAGGATGAGGAGGAGGG + Intergenic
946669587 2:222088603-222088625 TTGAAATTGAAGGGGGAGGAGGG + Intergenic
946724108 2:222644378-222644400 GAGAATGAAGAGGAGGAGGAAGG + Intronic
946740106 2:222792868-222792890 GTGAAGAAGGAGGAGGAGGAGGG - Intergenic
947235374 2:227935926-227935948 TTGCTTAAGGAGGAAGAGGAGGG + Intergenic
947370035 2:229436093-229436115 TTGAGTGGGGAGGAGGATGAGGG - Intronic
947771080 2:232670522-232670544 TTGAATCTGGAGGAGGAGGGTGG + Intronic
947901095 2:233722941-233722963 TGGGCTGAGGAGGAGGAGGAAGG + Intronic
948059102 2:235030627-235030649 CTGAGCTGGGAGGAGGAGGAGGG + Intronic
948080978 2:235204932-235204954 GTGAATTGGGATGAGGAAGAAGG - Intergenic
948648295 2:239422835-239422857 GTGAAGCAGGAGGAGCAGGAAGG + Intergenic
948883588 2:240872315-240872337 GTGAACATGGAGGAGGAGGAGGG + Intronic
948939284 2:241188031-241188053 GAGAATGAGGACGAGGAGGAGGG + Intergenic
1168741070 20:191928-191950 TAGAATTAGGAGAAGGAAAAAGG - Intergenic
1169474892 20:5922631-5922653 GAGGATGAGGAGGAGGAGGAGGG + Exonic
1169777652 20:9273600-9273622 GTGAAGGAGGAGGAAGAGGAAGG + Intronic
1169855890 20:10102312-10102334 TAGGATGAGGAGGAAGAGGAGGG - Intergenic
1169901105 20:10552337-10552359 CCTAATTAGGAGGAGGAGAAAGG + Intronic
1169954354 20:11084682-11084704 AAGAAGGAGGAGGAGGAGGAGGG + Intergenic
1170007947 20:11689191-11689213 TTGAATTAGATTGAGGAGTAGGG - Intergenic
1170602436 20:17851130-17851152 TGGGCTGAGGAGGAGGAGGAAGG + Intergenic
1170726372 20:18931040-18931062 TTGAACTAGAAAGAGAAGGATGG + Intergenic
1171040319 20:21756829-21756851 TAGGCTGAGGAGGAGGAGGAAGG + Intergenic
1171101496 20:22388014-22388036 GTAAATTATGAGGAAGAGGATGG + Intergenic
1171161388 20:22927288-22927310 TAGGCTGAGGAGGAGGAGGAAGG - Intergenic
1171850833 20:30306845-30306867 ATGAATGGGGAGGAAGAGGATGG - Intergenic
1172043035 20:32059460-32059482 AAGAAGGAGGAGGAGGAGGAAGG - Intronic
1172732083 20:37096451-37096473 TTGAGTTAGGAGATGGAGGCTGG + Intergenic
1172811337 20:37650257-37650279 ATGAAAGAGGAAGAGGAGGAGGG - Intergenic
1173808812 20:45943601-45943623 TGGAATTGGGATGAGGAGGGTGG + Intronic
1174239114 20:49118579-49118601 GTGCATTAGGAGAAGGAGGCAGG - Intronic
1174509618 20:51041237-51041259 TGGACTTAGGTGGAGGAGGGAGG - Intergenic
1174576468 20:51541443-51541465 TAGAGGGAGGAGGAGGAGGAGGG - Intronic
1174665402 20:52253492-52253514 TTGAATCAGGAGAAGGCTGAGGG + Intergenic
1174736813 20:52972747-52972769 GTGGAGGAGGAGGAGGAGGAGGG + Exonic
1174977446 20:55350977-55350999 TAGAATTAGGAGAAGGAAAAAGG + Intergenic
1175100624 20:56576247-56576269 GAGGAGTAGGAGGAGGAGGAGGG - Intergenic
1175100631 20:56576269-56576291 TAGAAGAAGGAGGAGGAAGAAGG - Intergenic
1175353449 20:58343208-58343230 TTGAACAAGGAGCAGGAAGATGG - Intronic
1175452092 20:59077925-59077947 GGGAAGAAGGAGGAGGAGGATGG + Intergenic
1176028567 20:62999051-62999073 TTGAAGGAGGAGGAGGAGTGGGG + Intergenic
1177115953 21:17087640-17087662 AAGAAAAAGGAGGAGGAGGAGGG + Intergenic
1177156932 21:17510336-17510358 AGGATTTAGGAGGAGGAGGGAGG - Intergenic
1177156946 21:17510377-17510399 AGGATTTAGGAGGAGGAGGGGGG - Intergenic
1177186804 21:17806540-17806562 ATGAATTAAGAGGGGGAGGCTGG + Intronic
1177507233 21:22034756-22034778 AAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1178029047 21:28504226-28504248 TTGCATAAGGAGGTGGGGGATGG - Intergenic
1178213149 21:30560665-30560687 AAGAATGACGAGGAGGAGGAGGG + Intronic
1178419527 21:32432488-32432510 TGGCATTAGGATGAAGAGGAAGG + Intronic
1178458373 21:32777269-32777291 ATGAACTAGGGGGTGGAGGATGG - Intergenic
1178493707 21:33070370-33070392 GTGGAGGAGGAGGAGGAGGAGGG - Exonic
1178692726 21:34763127-34763149 AAGAAGGAGGAGGAGGAGGAAGG - Intergenic
1178816405 21:35933963-35933985 CTGACTTAGAAGGAGAAGGAAGG + Intronic
1179081804 21:38178535-38178557 AAGAAGAAGGAGGAGGAGGAGGG + Intronic
1179258809 21:39740488-39740510 TAGAATTAGGAGAAGGAAAAAGG - Intergenic
1179554498 21:42163590-42163612 CTGGATGAGGGGGAGGAGGAGGG + Intergenic
1181495796 22:23286778-23286800 TTGGATTAGGAAGAGGGTGAGGG + Intronic
1181759881 22:25050995-25051017 GTGAAAGAGGAGGAGCAGGACGG - Intronic
1181860334 22:25813133-25813155 AGGAAGAAGGAGGAGGAGGAGGG - Intronic
1181931335 22:26403936-26403958 AAGAAGGAGGAGGAGGAGGAAGG + Intergenic
1182394542 22:30025997-30026019 TTGAAGGCAGAGGAGGAGGATGG - Exonic
1182469148 22:30536691-30536713 TTGAACAAGGAGGAGGAGGAGGG + Intronic
1182561908 22:31166606-31166628 AAGAAGGAGGAGGAGGAGGAGGG - Intronic
1182835537 22:33338461-33338483 AAGAAATAGGAGGAGGAGGTAGG - Intronic
1182913706 22:34008802-34008824 TTCAAGGGGGAGGAGGAGGATGG - Intergenic
1183175846 22:36224172-36224194 CTGAACTAGGAAGAGGAGAATGG + Intergenic
1183328432 22:37206731-37206753 GAGGATGAGGAGGAGGAGGATGG - Exonic
1183868086 22:40720119-40720141 TAGAAGGAGAAGGAGGAGGAAGG - Intergenic
1184117194 22:42429050-42429072 CTCAAGTGGGAGGAGGAGGATGG + Intronic
1184928400 22:47660741-47660763 ATGAAGAAGGAGGAAGAGGAGGG - Intergenic
1184989886 22:48160220-48160242 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
1185089424 22:48757394-48757416 GGGAAGGAGGAGGAGGAGGAAGG + Intronic
1185089436 22:48757433-48757455 GGGAAGGAGGAGGAGGAGGAGGG + Intronic
949250082 3:1973143-1973165 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
949250100 3:1973200-1973222 AAGAAGGAGGAGGAGGAGGAGGG + Intergenic
949782247 3:7702775-7702797 TTGAATAATTAGGAAGAGGATGG + Intronic
949828812 3:8191807-8191829 AAGAAGGAGGAGGAGGAGGAGGG - Intergenic
950789995 3:15463977-15463999 TTGAAATAGGGAGAGGAGGAAGG - Intronic
950845132 3:16008017-16008039 TTGCATTAGGATGATGTGGAGGG + Intergenic
951554432 3:23906537-23906559 TAGACTGAGGAGAAGGAGGAGGG - Intronic
952670676 3:35963676-35963698 TGGAATAAGCAGGAGGAAGAAGG + Intergenic
952700094 3:36318536-36318558 ATGGAGGAGGAGGAGGAGGAAGG - Intergenic
953230239 3:41058297-41058319 GAGAAGAAGGAGGAGGAGGAGGG + Intergenic
953230250 3:41058328-41058350 GTGGAGGAGGAGGAGGAGGAGGG + Intergenic
954354746 3:50075518-50075540 TGGAGTTAGGAAGAGAAGGAAGG + Intronic
954594743 3:51814708-51814730 CTGCTTTAGGAGGAGGAGGAGGG - Intergenic
954911375 3:54113689-54113711 TTGAAAGAGGAGGAGAAGGAGGG - Intergenic
955080489 3:55653965-55653987 AGGAATGAGGAGGAAGAGGAGGG - Intronic
955087826 3:55720104-55720126 AAGAAGGAGGAGGAGGAGGAGGG - Intronic
955148544 3:56344317-56344339 GAGAATGAGGAGGAGGAGGAGGG - Intronic
955472638 3:59301834-59301856 TTGAATCAGGAGGAAGTGGGAGG + Intergenic
955850996 3:63219785-63219807 TAGACTGAGGAGGAGGAGGAAGG + Intergenic
956040489 3:65140115-65140137 TTCAATGATGAGGAGGATGATGG - Intergenic
956049761 3:65235373-65235395 ATGGAGTAGGAGGTGGAGGATGG - Intergenic
956198803 3:66683940-66683962 AAGAAAAAGGAGGAGGAGGAGGG - Intergenic
956212623 3:66817301-66817323 AAGAAGGAGGAGGAGGAGGAAGG + Intergenic
956769803 3:72515580-72515602 TTCAATTAGGTGTCGGAGGATGG - Intergenic
956999953 3:74874060-74874082 TAGAATTAGGAGAAGGAAAAAGG - Intergenic
957150061 3:76475334-76475356 TTGAATGAGGATGAAGTGGAAGG + Intronic
957400725 3:79709699-79709721 TTGAATTTGGGGCAGGCGGAGGG - Intronic
958157765 3:89776246-89776268 AAGAAAGAGGAGGAGGAGGAGGG - Intergenic
958442869 3:94177923-94177945 CGGAACTTGGAGGAGGAGGAAGG + Intergenic
958584087 3:96062809-96062831 GGGAAGTAGGAGGAGGAGGAAGG - Intergenic
960058398 3:113293757-113293779 GTGAATTAGGAGGATTGGGAAGG - Intronic
960130442 3:114050488-114050510 TGGGATTAGGAGGTGGAGGTAGG + Intronic
960396550 3:117144485-117144507 ATGAGTGAGCAGGAGGAGGAAGG + Intergenic
960476155 3:118131166-118131188 TTGACATAGGAAGAAGAGGAAGG + Intergenic
960682644 3:120265073-120265095 ATGACTTAGGAGAAGCAGGAGGG + Intronic
961112653 3:124298167-124298189 TGGAGCTAGGAGGAGGAAGATGG + Intronic
961153192 3:124657166-124657188 TTGGATTGGGAGAAGGAAGAGGG + Intronic
961345369 3:126260398-126260420 TTGGATTAGGGTTAGGAGGAGGG - Intergenic
961345384 3:126260457-126260479 TTGGATTAGGGTTAGGAGGAGGG - Intergenic
961516286 3:127439416-127439438 TTAAGCAAGGAGGAGGAGGAGGG + Intergenic
961596995 3:128025663-128025685 TTGAACCAGGAGGTGGAGGTTGG + Intergenic
961609986 3:128129011-128129033 TGACATTAGGAGGGGGAGGAGGG - Intronic
961726428 3:128933892-128933914 ATGAAGGAGGAGGAGGAGGCTGG - Intronic
961884433 3:130086899-130086921 TGGCATTAGGATGAAGAGGAAGG - Intronic
962051558 3:131821095-131821117 CTGAAGGAGGAGGAGGAGGTTGG + Intronic
962054411 3:131854796-131854818 GAGAAGGAGGAGGAGGAGGAGGG - Intronic
962664746 3:137642621-137642643 TTTATTTAGGGGGAGGGGGAGGG + Intergenic
962883896 3:139605209-139605231 ATGAATAAGGATGAGGAGGAAGG - Intronic
962922421 3:139963088-139963110 GAGAATGAGGAGGAGGAGGGGGG + Intronic
963188291 3:142442095-142442117 TAGAATTAGGAGAAGGAAAAAGG + Intronic
963253228 3:143120577-143120599 GTTACTTAGGAGGAGGAGGCTGG + Intronic
963916090 3:150860092-150860114 TAGAATTAGGAGAAGGAAAAAGG + Intergenic
964374401 3:156035408-156035430 AAGAAGAAGGAGGAGGAGGAGGG - Intergenic
964441716 3:156718169-156718191 TAGGCTGAGGAGGAGGAGGAAGG + Intergenic
964445442 3:156752780-156752802 AAGAAGGAGGAGGAGGAGGAGGG + Intergenic
964568135 3:158080875-158080897 AAGAAGGAGGAGGAGGAGGAGGG + Intergenic
965498705 3:169431251-169431273 TTCAAGTGGGAGGAGTAGGAAGG + Intronic
965825269 3:172723294-172723316 TAGAATTAGGAGAAGGAAAAAGG + Intergenic
965910792 3:173772840-173772862 TGCAATTAGGAGGAGGAGTCTGG - Intronic
965986818 3:174763932-174763954 TTAAAATAGGAAGAGGAAGAAGG - Intronic
966104454 3:176319530-176319552 AAGAAGGAGGAGGAGGAGGAGGG + Intergenic
966353891 3:179058902-179058924 TAGAATTAGGAGAAGGAAAAAGG + Intronic
966466891 3:180239189-180239211 TTTAGTTATGAGGAGGAGAATGG + Intergenic
966559211 3:181300141-181300163 GGGAAGGAGGAGGAGGAGGAGGG + Intergenic
966951228 3:184819992-184820014 TAGGCTGAGGAGGAGGAGGAGGG + Intronic
967336695 3:188352088-188352110 TTAAGTCAGGAGAAGGAGGAAGG - Intronic
967403811 3:189094377-189094399 TGGAATGAGGAAGAGAAGGAGGG - Intronic
967623878 3:191664339-191664361 TAGAATTAGGAGAAGGAAAAAGG + Intergenic
968161611 3:196431962-196431984 ATGATGAAGGAGGAGGAGGAGGG + Intronic
968161612 3:196431965-196431987 ATGAAGGAGGAGGAGGAGGGCGG + Intronic
968313556 3:197703741-197703763 ATGAATGAGGAGGAGGGTGAAGG + Intronic
968359906 3:198139613-198139635 GAGAATTAGGAAGAGGAAGAGGG + Intergenic
968391065 4:193451-193473 TAGAATTAGGAGAAGGAAAAAGG - Intergenic
968914442 4:3491156-3491178 ATGAATGAGCAGGAGGAAGAAGG - Intronic
969511386 4:7620017-7620039 AGGAAGGAGGAGGAGGAGGAAGG - Intronic
969511391 4:7620033-7620055 AGGAAGGAGGAGGAGGAGGAAGG - Intronic
969820343 4:9715384-9715406 TGGCATTAGGATGAAGAGGAAGG + Intergenic
970018083 4:11535052-11535074 TTGCATTTGGAGATGGAGGAGGG + Intergenic
970113926 4:12671431-12671453 TTGGCTGAGGAGGAGGAGGAGGG + Intergenic
970827308 4:20291367-20291389 TTGGCTGAGGAGGAGGAGAATGG + Intronic
971766277 4:30835824-30835846 TTAAAATGGGAGGAGGAGGAGGG + Intronic
972781025 4:42287039-42287061 TAGAATTAGGAGAAGGAAAAAGG - Intergenic
973803289 4:54499422-54499444 ATTAACTAGAAGGAGGAGGAGGG - Intergenic
975388524 4:73788134-73788156 GAGAAGGAGGAGGAGGAGGAAGG + Intergenic
975495415 4:75030890-75030912 ATGTAAGAGGAGGAGGAGGAGGG + Intronic
976464623 4:85353355-85353377 TAGAATTAGGAGAAGGAAAAAGG - Intergenic
976874520 4:89837160-89837182 GAGGACTAGGAGGAGGAGGACGG - Intronic
977094684 4:92725218-92725240 TTGAACTGGGAGGTGGAGGGAGG + Intronic
977617904 4:99105995-99106017 TAGAATTAGGAGAAGGAAAAAGG - Intergenic
977731095 4:100352919-100352941 AAGAAGGAGGAGGAGGAGGAGGG + Intergenic
978257265 4:106707898-106707920 GTGAATTAAGATGATGAGGAAGG + Intergenic
978514134 4:109553337-109553359 GATAATGAGGAGGAGGAGGAAGG - Intergenic
978586465 4:110280433-110280455 TAGAATTAGGAGAAGGAAAAAGG - Intergenic
978737422 4:112099747-112099769 TTGAATTGGCAAGAGGAGGAGGG + Intergenic
978816095 4:112907496-112907518 TGAAAGTAGGATGAGGAGGAGGG - Intronic
978935609 4:114371416-114371438 GAGAAGGAGGAGGAGGAGGAAGG - Intergenic
979210849 4:118100199-118100221 TAGAACTAAGAGGTGGAGGAAGG + Intronic
979276964 4:118824826-118824848 GAGAACTAGGTGGAGGAGGAGGG + Intronic
979302791 4:119106697-119106719 TTTCACTAGGAGGAGAAGGATGG - Intergenic
980135120 4:128851264-128851286 TAGAAGTAAGAGGATGAGGAGGG + Intronic
980444553 4:132887889-132887911 TAGAATTAGGAGAAGGAAAAAGG + Intergenic
981025053 4:140069476-140069498 AAGAAGAAGGAGGAGGAGGAGGG + Intronic
981025068 4:140069537-140069559 AAGAAGAAGGAGGAGGAGGAGGG + Intronic
981041637 4:140228244-140228266 ATGAAGAAGGAGGAGGAGGAGGG - Intergenic
981216624 4:142177084-142177106 CTGAATTAGGAGAAAGAGGCAGG - Intronic
981254402 4:142644303-142644325 GAGAAGGAGGAGGAGGAGGAGGG + Intronic
981295600 4:143127379-143127401 TAGAAGGAAGAGGAGGAGGAAGG + Intergenic
982125178 4:152178043-152178065 AGTAATAAGGAGGAGGAGGAAGG + Intergenic
982173637 4:152684721-152684743 TTGGGTTAGGGGGAGGAGGAAGG - Intergenic
982215658 4:153080723-153080745 TTGGATGAGGAGGTGCAGGAGGG - Intergenic
982742612 4:159073625-159073647 CTGGATTAGGAGAGGGAGGATGG - Intergenic
982868460 4:160546701-160546723 TTTAAATGAGAGGAGGAGGAAGG - Intergenic
982905047 4:161057395-161057417 TTGAAGTAGGATGAGAAGGATGG - Intergenic
983102293 4:163639781-163639803 TCTAATAAGGAGGAGGAGTAAGG + Intronic
983589337 4:169390392-169390414 TAGGCTGAGGAGGAGGAGGAAGG + Intergenic
983647895 4:170010512-170010534 TAGACTGAGGAGGAGGGGGAGGG - Intronic
983650079 4:170028348-170028370 CTGTCTAAGGAGGAGGAGGATGG + Intronic
983990055 4:174107659-174107681 TTGGTTTCAGAGGAGGAGGAAGG + Intergenic
984251375 4:177339555-177339577 TAGATTGAGGAGGAAGAGGAGGG + Intronic
984724064 4:183003154-183003176 TAGAATTAGGAGAAGGAAAAAGG + Intergenic
985606552 5:861212-861234 CTGAATTGGGAGGCAGAGGAGGG - Intronic
985985747 5:3515015-3515037 TTCACTGATGAGGAGGAGGATGG - Intergenic
986534424 5:8772192-8772214 TAGGATTTTGAGGAGGAGGAAGG + Intergenic
987095454 5:14545614-14545636 GAGAAGGAGGAGGAGGAGGAAGG - Intergenic
987241957 5:16009041-16009063 GAGAAGGAGGAGGAGGAGGAGGG + Intergenic
987747925 5:22001299-22001321 ATTAATAAGGAGGAGGGGGACGG - Intronic
987961470 5:24814585-24814607 CTGAATTTGGATGAGGAAGAGGG + Intergenic
988246449 5:28688741-28688763 AAGAAGGAGGAGGAGGAGGAAGG - Intergenic
988660462 5:33261582-33261604 TTGGAGGAGGAGGAGGAGGTGGG + Intergenic
988827560 5:34953370-34953392 GTTACTTAGGAGGAGGAGCAGGG - Intronic
988956980 5:36329923-36329945 TAGAATTAGGAGAAGGAAAAAGG - Intergenic
989762680 5:45037503-45037525 TTAAAATATGGGGAGGAGGACGG - Intergenic
990526975 5:56637648-56637670 ATGGCTTTGGAGGAGGAGGAGGG + Intergenic
990774935 5:59295761-59295783 CTGAGGTAGGAGGAGGAGAATGG - Intronic
991021690 5:61985883-61985905 TTGAATGAGGAAGGGAAGGAAGG + Intergenic
991116140 5:62957709-62957731 GAGAAGAAGGAGGAGGAGGAGGG + Intergenic
991361027 5:65820497-65820519 TTAAATTAGTGGGAGGAGCATGG - Intronic
991529012 5:67594988-67595010 AGGAATTAGGAGGAAGAGGCAGG + Intergenic
992030207 5:72713513-72713535 TTGAACAAAAAGGAGGAGGAAGG + Intergenic
992090644 5:73312955-73312977 AAGAAGGAGGAGGAGGAGGAAGG - Intergenic
992201011 5:74383977-74383999 GTGGATGAGGAGGAGAAGGAGGG + Intergenic
992349716 5:75916396-75916418 GTGGAGGAGGAGGAGGAGGAAGG - Intergenic
993158363 5:84256752-84256774 TTGAATCAGATGGAGGAGGTTGG + Intronic
994337416 5:98584208-98584230 TTGCATTAGAAGGAGAAGAAGGG - Intergenic
994825392 5:104707621-104707643 AAGAAGAAGGAGGAGGAGGAAGG + Intergenic
995465968 5:112449799-112449821 TAGAATTAGGAGAAGGAAAAAGG + Intergenic
996281050 5:121729288-121729310 TTACAGTAGGAAGAGGAGGAGGG - Intergenic
996587580 5:125107739-125107761 TAGAAGGAGGAGAAGGAGGAGGG - Intergenic
997037088 5:130205830-130205852 TGGAATGAGAAGGAGGAGGGTGG - Intergenic
997297226 5:132776155-132776177 GAGAAGGAGGAGGAGGAGGAGGG - Intronic
998090470 5:139364137-139364159 CTGAATCAGGAGGATGAGGGTGG + Intronic
998425375 5:142022232-142022254 ATCATTTAAGAGGAGGAGGAAGG + Intergenic
998611516 5:143694313-143694335 TTTAAAAAGGAGGAGGAGGAGGG - Intergenic
998933953 5:147214598-147214620 AAGAAGGAGGAGGAGGAGGAGGG - Intergenic
999432636 5:151537276-151537298 GTGGAGGAGGAGGAGGAGGAGGG + Intronic
1001132907 5:169079549-169079571 AGGAAGAAGGAGGAGGAGGAAGG + Intronic
1001310045 5:170604046-170604068 TTGAAGTAGGATGGAGAGGAAGG + Intronic
1001555880 5:172637020-172637042 TTGAGTTGTGAGGAGGAGGCTGG + Intergenic
1001600099 5:172923072-172923094 TAGGAGGAGGAGGAGGAGGAGGG + Intronic
1001600113 5:172923131-172923153 TGGGAGGAGGAGGAGGAGGAGGG + Intronic
1001600127 5:172923190-172923212 TGGGAGGAGGAGGAGGAGGAGGG + Intronic
1001770935 5:174295277-174295299 AAGAAATAGGAGGAGGAAGAGGG + Intergenic
1001861333 5:175058227-175058249 TTGCATTGGGAGGAGGAGCATGG + Intergenic
1001960507 5:175877869-175877891 GTGATTTAGGAAGAGGAGTAGGG + Intronic
1002743887 5:181455356-181455378 TGGAAAGAGGAGGAGGAGGACGG + Intergenic
1003101206 6:3177664-3177686 TTGACTATGGAGGAGGAGGTAGG + Intergenic
1003226694 6:4212390-4212412 TTGCAGTAGCTGGAGGAGGAAGG - Intergenic
1003466347 6:6383544-6383566 TGCATTCAGGAGGAGGAGGAAGG - Intergenic
1003656475 6:8015412-8015434 TTGAATGAAGAGGAGTAGGAAGG - Exonic
1003722344 6:8718006-8718028 AAGAAGGAGGAGGAGGAGGAGGG - Intergenic
1003817626 6:9859942-9859964 ATGAAGAAGGAGGAGGAGAAGGG + Intronic
1004119676 6:12808834-12808856 AAGAAGGAGGAGGAGGAGGAGGG - Intronic
1004485623 6:16063644-16063666 TAGGAGGAGGAGGAGGAGGAGGG + Intergenic
1004536211 6:16504954-16504976 TTGCAGGAGGAGGAGGAGGTGGG - Intronic
1004571915 6:16854394-16854416 TTGAGTTAGGAGAATGAGGAAGG + Intergenic
1005002975 6:21261302-21261324 AAGAAGAAGGAGGAGGAGGAAGG + Intergenic
1005092946 6:22078398-22078420 TTGTATTAGGAGAAGCATGATGG - Intergenic
1005955384 6:30659886-30659908 TTGAATTGGGAGGAGAGGAAAGG - Intronic
1006299594 6:33186492-33186514 ATGAATGAGGACTAGGAGGAGGG + Intronic
1006650191 6:35545037-35545059 GTGAAGCAAGAGGAGGAGGAGGG + Intergenic
1006715571 6:36117398-36117420 AGGAATGAGGAGGAGGAAGAGGG - Intergenic
1007090462 6:39181248-39181270 TTGTGGTAGGAGGTGGAGGAAGG - Intergenic
1007563692 6:42831676-42831698 CTGAATGTGGAGGAGGAGAAAGG - Intronic
1007564662 6:42840614-42840636 TTGAACTGGGAGGTGGAGGTTGG - Intronic
1008014235 6:46500539-46500561 TTGAAGAAGTAGGAGGAGGCTGG - Intergenic
1008071584 6:47103904-47103926 TTAAAGTAGGAAGAGGAGTATGG - Intergenic
1008288372 6:49682480-49682502 GAGGAATAGGAGGAGGAGGAGGG - Intergenic
1008818990 6:55608603-55608625 TTGAATTAAGAGGATAAGAAAGG - Intergenic
1008938235 6:57015877-57015899 TTGACTTAGGAGGGAGAAGAAGG + Intronic
1009565435 6:65306110-65306132 TATAATCAGGAGGAAGAGGAAGG + Intronic
1010116740 6:72321603-72321625 TTGAATTAGGAAGAGGACTGGGG - Intronic
1010311404 6:74390030-74390052 AAGAAGGAGGAGGAGGAGGAAGG - Intergenic
1011077110 6:83449153-83449175 TAGAATTAGGAGAAGGAAAAAGG + Intergenic
1011160835 6:84388649-84388671 ATGAATTAGGAGGGGAAGAAGGG + Intergenic
1011484792 6:87830139-87830161 AAGAAGGAGGAGGAGGAGGAGGG - Intergenic
1011553309 6:88549277-88549299 AAGAAAGAGGAGGAGGAGGAAGG - Intergenic
1011742617 6:90377649-90377671 AAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1012165669 6:95948056-95948078 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
1013101062 6:106987142-106987164 TTGAGGGAGGAGGAGGAGGAGGG + Intergenic
1013543880 6:111136848-111136870 TAGAATTAGGAGAAGGAAAAAGG + Intronic
1013922215 6:115419799-115419821 CAGAAGGAGGAGGAGGAGGAGGG + Intergenic
1013948962 6:115756262-115756284 TTCAATTTGGGGAAGGAGGAAGG + Intergenic
1014490721 6:122058497-122058519 TTGAATTAGAATGAGGAGAAAGG + Intergenic
1014561912 6:122901174-122901196 AAGAAGGAGGAGGAGGAGGAAGG - Intergenic
1014711617 6:124812896-124812918 TAGAATTAGGAGAATGAGGAAGG - Intronic
1014737897 6:125116152-125116174 TAGAAATAGGGAGAGGAGGATGG + Intergenic
1014869973 6:126581949-126581971 AAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1015181988 6:130370401-130370423 TGGGATGAGGAGGAGGAGGCTGG + Intronic
1015541317 6:134317173-134317195 TTGCATTGGGAGGAGGGGGTTGG - Intronic
1015865159 6:137720170-137720192 TAGAATTAGGAGAAGGAAAAAGG - Intergenic
1017037641 6:150280737-150280759 TTGAATGAGCACCAGGAGGAAGG + Intergenic
1017591522 6:155983118-155983140 TTCTGTTAGGAGGAGAAGGAAGG - Intergenic
1017688819 6:156942741-156942763 AAGCAATAGGAGGAGGAGGATGG - Intronic
1018220205 6:161570501-161570523 GTGGCTGAGGAGGAGGAGGAGGG - Intronic
1018437595 6:163776875-163776897 GAGGATGAGGAGGAGGAGGAGGG + Intergenic
1018577705 6:165276753-165276775 TTCCATGAGGATGAGGAGGAAGG - Intergenic
1018996730 6:168715904-168715926 GAGGATGAGGAGGAGGAGGATGG + Intergenic
1019248746 6:170728585-170728607 TGGAAAGAGGAGGAGGAGGACGG + Intergenic
1019260082 7:77036-77058 GAGAATTAGGAAGAGGAAGAGGG - Intergenic
1019783470 7:2958656-2958678 TTGGAGCAGGAGGCGGAGGATGG + Intronic
1019794744 7:3041363-3041385 AAGAATTAGGAGGAGTGGGAAGG - Intronic
1019954977 7:4406074-4406096 TAGGAGGAGGAGGAGGAGGAAGG + Intergenic
1020410262 7:7884468-7884490 TTGAACTTCAAGGAGGAGGAAGG + Intronic
1020461360 7:8433541-8433563 GTGAAGGGGGAGGAGGAGGACGG - Intergenic
1020508197 7:9019651-9019673 TAGAATTAGGAGAAGGAAAAAGG + Intergenic
1020577401 7:9950017-9950039 GAGAAGGAGGAGGAGGAGGAAGG + Intergenic
1020680618 7:11232473-11232495 TTGAAAGAGAAGGTGGAGGAGGG + Intergenic
1021075163 7:16294528-16294550 TTGAATTAGTAAAAGCAGGAAGG - Intronic
1021322159 7:19225800-19225822 TTGAGTTAGAGGTAGGAGGAAGG - Intergenic
1021622461 7:22562254-22562276 AAGAAGAAGGAGGAGGAGGAGGG - Intronic
1022604207 7:31792373-31792395 TTGAATAAGCATGAGGAGGATGG + Intronic
1022749105 7:33204596-33204618 CTGAATGAAGAGTAGGAGGAAGG - Intronic
1022806519 7:33828177-33828199 TTGAATTAAATGGGGGAGGAGGG - Intergenic
1023048610 7:36232551-36232573 ATGCATTAGGAGTAGGGGGAGGG - Intronic
1023326823 7:39069820-39069842 TAGGTTGAGGAGGAGGAGGAAGG + Intronic
1024109795 7:46133651-46133673 GTCAAAGAGGAGGAGGAGGAGGG - Intergenic
1024195568 7:47055368-47055390 GAGAAGGAGGAGGAGGAGGAGGG - Intergenic
1024478348 7:49838172-49838194 GTGAATTAGGAGGCAGAGGCAGG + Intronic
1024677254 7:51647779-51647801 TTGGATGAGGAGGAGGAGGAAGG - Intergenic
1024846259 7:53646192-53646214 AAGAAGAAGGAGGAGGAGGAAGG - Intergenic
1025815235 7:64904622-64904644 GTGAATTAGGATGAGGAAGTTGG - Intronic
1026158947 7:67852194-67852216 TAGAATAAGGAAGATGAGGAGGG + Intergenic
1026283014 7:68938365-68938387 TTGAATGAGGAGTAGGTGAATGG - Intergenic
1026534652 7:71229780-71229802 TCGAACTAGGTGGAGGCGGAGGG - Intronic
1026638631 7:72105766-72105788 AAGAAGGAGGAGGAGGAGGAGGG + Intronic
1026662088 7:72311113-72311135 TAGACTGAAGAGGAGGAGGAGGG - Intronic
1026905066 7:74058102-74058124 AAGAATGAGAAGGAGGAGGAGGG - Intronic
1026917452 7:74129504-74129526 AGGAAGAAGGAGGAGGAGGAGGG + Intergenic
1027591042 7:80119669-80119691 TTGAATCAGAAGTAGCAGGAGGG - Intergenic
1028234904 7:88348587-88348609 TTTAACTAGAAGGAGGAAGAAGG + Intergenic
1028246828 7:88489565-88489587 AAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1028534782 7:91880541-91880563 TTGTCTTTGGAGGAGGAAGAGGG - Intronic
1028839519 7:95412840-95412862 TTGAATCAGTGGGAGAAGGATGG - Intronic
1028898419 7:96067837-96067859 ATTACTTAGGAGGAGGAGGTTGG - Intronic
1028955149 7:96681000-96681022 CTGACTTAAGAGGATGAGGAGGG + Intronic
1029004884 7:97198871-97198893 ATGCATTGGGAGAAGGAGGAGGG - Intergenic
1029584404 7:101461288-101461310 AAGAAGGAGGAGGAGGAGGAGGG - Intronic
1029856138 7:103518737-103518759 GTAAAGTAGGAGGAGGAAGAGGG - Intronic
1029886461 7:103877810-103877832 AAGAAGAAGGAGGAGGAGGAAGG - Intronic
1029983689 7:104902419-104902441 GAGAAGGAGGAGGAGGAGGAGGG + Intronic
1030843170 7:114380318-114380340 TAGAATTAGGAGAAGGAAAATGG - Intronic
1030860130 7:114615348-114615370 TAGATTTATGAGGAGGAAGAGGG - Intronic
1030952750 7:115812384-115812406 TTGAATTCAGAGGAGGAGAGGGG + Intergenic
1031153795 7:118085523-118085545 TTGAAAATGGAGGAGGAGTAGGG - Intergenic
1031762917 7:125737116-125737138 AAGAAGGAGGAGGAGGAGGAGGG + Intergenic
1031943596 7:127815493-127815515 AAGAAGAAGGAGGAGGAGGAGGG + Intronic
1032473074 7:132192394-132192416 AGGAAGAAGGAGGAGGAGGAAGG + Intronic
1032510929 7:132471713-132471735 TTGGAGTGGGAGGAGGAGGAGGG + Intronic
1032917215 7:136505512-136505534 TGGCAATAGGAGGAGGAAGAAGG + Intergenic
1032957605 7:136989611-136989633 TTGAATTTGGAGAATGAGGGAGG - Intronic
1033446104 7:141423533-141423555 TAGAATATGGAGGAGGAGGAGGG + Intronic
1033824303 7:145170783-145170805 TTGAATTATGAAGATGATGAAGG + Intergenic
1034242212 7:149619294-149619316 TAGACTGAGGAGGAAGAGGAGGG - Intergenic
1034248609 7:149670048-149670070 CAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1034309597 7:150075357-150075379 TTGAATTGGAAAGAGGAGAAGGG - Intergenic
1034406054 7:150903127-150903149 GTGAAGGAGAAGGAGGAGGAGGG - Intergenic
1034797262 7:154025284-154025306 TTGAATTGGAAAGAGGAGAAGGG + Intronic
1034859339 7:154582536-154582558 AGGAAACAGGAGGAGGAGGAAGG - Intronic
1034945447 7:155259051-155259073 GGGAAGGAGGAGGAGGAGGAGGG - Intergenic
1034945486 7:155259156-155259178 AAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1034964441 7:155382741-155382763 TTGAATTCCAAGGAGGAAGAGGG - Intronic
1035160337 7:156945188-156945210 TTGGAGGAGGAGGAGGGGGAGGG - Intergenic
1035416887 7:158696723-158696745 TGGACTTAGGAGGAGGAGGGTGG - Intronic
1035499299 8:78750-78772 TGGAAAGAGGAGGAGGAGGACGG - Intronic
1035722057 8:1799318-1799340 TTGGAGGAGGAGGAGGAGGAGGG - Intergenic
1035827634 8:2661401-2661423 CTGGATTAGGAGGAGGACTAAGG + Intergenic
1036053095 8:5222054-5222076 TAGGGTGAGGAGGAGGAGGAAGG + Intergenic
1036126605 8:6068653-6068675 AGGAATGAGGAGGAGAAGGAAGG - Intergenic
1036154019 8:6325346-6325368 TGGAATAAGGAGCTGGAGGATGG - Intergenic
1036521684 8:9497769-9497791 CTAAAGAAGGAGGAGGAGGAAGG - Intergenic
1037096473 8:14992759-14992781 TTGAATGAGGAGGATGGGGGAGG - Intronic
1037096486 8:14992819-14992841 TTGAATGAGGAGGATGGGGGAGG - Intronic
1037778864 8:21854159-21854181 GAGAAGGAGGAGGAGGAGGAAGG + Intergenic
1038119558 8:24597412-24597434 GTGAATTAGGAGGAGTTGGATGG + Intergenic
1038313415 8:26463163-26463185 GAGAAGGAGGAGGAGGAGGAAGG - Intronic
1038419228 8:27421678-27421700 TTGAAATAGGCTGAGGAGGGGGG - Intronic
1038483642 8:27918788-27918810 GAGAAAGAGGAGGAGGAGGAGGG + Intronic
1038483763 8:27919277-27919299 GTGAAGGAGGAGGATGAGGAGGG + Intronic
1038775312 8:30525361-30525383 TTTATTGCGGAGGAGGAGGAAGG - Intronic
1038839875 8:31174723-31174745 AAGAAGGAGGAGGAGGAGGAAGG - Intergenic
1038900842 8:31841994-31842016 TAGAATGGGGAGGAGGAGGAGGG - Intronic
1039177306 8:34824453-34824475 TGGAATTTGGAAAAGGAGGATGG - Intergenic
1039347047 8:36716668-36716690 GTGATTCAGGAGGAGGAGGAAGG - Intergenic
1039363993 8:36911196-36911218 TTTAATTATGGGGAGCAGGAGGG + Intronic
1039554440 8:38466688-38466710 TTTAATTTGGGGGAGGGGGAGGG + Intronic
1039827273 8:41185192-41185214 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
1040548728 8:48422317-48422339 TGGAGCCAGGAGGAGGAGGAGGG + Intergenic
1041291190 8:56310194-56310216 AGGAAGGAGGAGGAGGAGGAAGG + Intronic
1041291195 8:56310210-56310232 AGGAAGGAGGAGGAGGAGGAAGG + Intronic
1041291200 8:56310226-56310248 AGGAAGGAGGAGGAGGAGGAAGG + Intronic
1041291205 8:56310242-56310264 AGGAAGGAGGAGGAGGAGGAAGG + Intronic
1041291210 8:56310258-56310280 AGGAAGGAGGAGGAGGAGGAAGG + Intronic
1041291215 8:56310274-56310296 AGGAAGGAGGAGGAGGAGGAAGG + Intronic
1041291220 8:56310290-56310312 AGGAAGGAGGAGGAGGAGGAAGG + Intronic
1041291229 8:56310319-56310341 AGGAAGGAGGAGGAGGAGGAAGG + Intronic
1041663538 8:60421524-60421546 TAGAATTAGGAGAAGGAAAAAGG - Intergenic
1041733554 8:61087081-61087103 TTGATTTCGGAGCTGGAGGATGG - Intronic
1041831536 8:62160688-62160710 AAGAAGTAGGAGGAGGAGGAAGG + Intergenic
1041846977 8:62340465-62340487 GTGAAATAGGAGAAGGAGAAAGG + Intronic
1042056222 8:64767116-64767138 TAGAATTAGGAGAAGGAAAAAGG + Intronic
1042364602 8:67922384-67922406 TAGAATTAGGAGAAGGAAAAAGG + Intergenic
1042815576 8:72874729-72874751 TTGTGTCAGGAGCAGGAGGAGGG + Intronic
1042987958 8:74604454-74604476 GTGGAGGAGGAGGAGGAGGAAGG + Intronic
1043499505 8:80838670-80838692 CTGGAGGAGGAGGAGGAGGAGGG + Intronic
1044244429 8:89925501-89925523 TTGAAAGAGGAGGAGGAGATGGG + Exonic
1044463109 8:92470528-92470550 TTGACTTATGAGATGGAGGAGGG - Intergenic
1044613283 8:94115287-94115309 CTACATTAGGAAGAGGAGGAGGG - Intergenic
1044831147 8:96250675-96250697 AAGAAGAAGGAGGAGGAGGAGGG + Intronic
1045130036 8:99140687-99140709 GAGAAGGAGGAGGAGGAGGAGGG - Intronic
1045231391 8:100310128-100310150 AAGAAGTGGGAGGAGGAGGAGGG - Intronic
1045358607 8:101411788-101411810 GAGAAGGAGGAGGAGGAGGAAGG - Intergenic
1045451545 8:102331760-102331782 ATGAATTAGGGAGAGAAGGATGG - Intronic
1045473693 8:102535772-102535794 TTGAATGAAGTGGAGGAGGCAGG + Intronic
1045824978 8:106386629-106386651 TTGACTTAGGGGTTGGAGGAGGG - Intronic
1046109110 8:109700354-109700376 TTGGCTGAGAAGGAGGAGGAGGG - Intergenic
1046399937 8:113691896-113691918 GAGAAAGAGGAGGAGGAGGAGGG - Intergenic
1046797360 8:118387464-118387486 TACAATTATGAGGAGGAGGAGGG - Intronic
1047089167 8:121554872-121554894 TTGAATAATAAGGAGGAGAAGGG + Intergenic
1047196980 8:122730521-122730543 TTCAAATAGGAGGAAGAGGAAGG - Intergenic
1047308190 8:123670214-123670236 TCAAAGGAGGAGGAGGAGGAAGG - Intergenic
1047702565 8:127464240-127464262 TAGGAGAAGGAGGAGGAGGAGGG - Intergenic
1048130096 8:131686398-131686420 TAGAAATTGGAGGAGGAAGACGG - Intergenic
1048317294 8:133371606-133371628 AGGAAGCAGGAGGAGGAGGAAGG + Intergenic
1048462895 8:134637469-134637491 CTGAATTTGGGTGAGGAGGAAGG - Exonic
1048468876 8:134689513-134689535 CTGAATTAGGGGAAGGAGGCTGG - Intronic
1048714783 8:137256282-137256304 ATGAATTAGGTGGAGGTGGATGG + Intergenic
1048752663 8:137697637-137697659 TTGATTGAGGAGCAGGAGGTCGG - Intergenic
1049024265 8:139977975-139977997 TTAAATTAGGAGTAGGAGGCTGG - Intronic
1049036448 8:140079966-140079988 AAGAAGGAGGAGGAGGAGGAGGG + Intronic
1049252844 8:141598385-141598407 CTGAATTAGGAGGCGGAGATGGG - Intergenic
1049286435 8:141777954-141777976 TGGAACCAGGAGGAGGAGGCTGG + Intergenic
1049295170 8:141829250-141829272 GTGAATGAGCAGGAGGAGGAGGG + Intergenic
1050861969 9:10446136-10446158 TTGAAATAGAAAGAGGAGAAAGG + Intronic
1050882687 9:10722570-10722592 AGGAATTTAGAGGAGGAGGAAGG + Intergenic
1050942177 9:11473203-11473225 TAGAAGGAGGAGGAGAAGGAGGG + Intergenic
1051138344 9:13949989-13950011 TTGCCTTAGAAGGATGAGGATGG + Intergenic
1051170386 9:14314705-14314727 GAGAAGGAGGAGGAGGAGGAAGG - Intronic
1051666978 9:19474823-19474845 ATTGATAAGGAGGAGGAGGAGGG - Intergenic
1052305680 9:27006663-27006685 GGGAAGGAGGAGGAGGAGGAAGG + Intronic
1052417919 9:28201811-28201833 TTTAAATAGGGGGAGGAGGAAGG - Intronic
1053205456 9:36182576-36182598 TGGGAATAGGGGGAGGAGGAAGG + Intergenic
1053206665 9:36191773-36191795 TTGGATTACGAGGAGGAAGGAGG + Intronic
1053216198 9:36272658-36272680 ATGGATTGGGAAGAGGAGGAAGG + Intronic
1053225350 9:36350395-36350417 TTGAATATTGTGGAGGAGGAAGG - Intronic
1053449140 9:38178987-38179009 TGGAATGAGGAGGAGGTGGAAGG - Intergenic
1054130776 9:61362147-61362169 AGGAAGGAGGAGGAGGAGGAAGG - Intergenic
1055266071 9:74497565-74497587 TGGACTGAGGAGGAGGAGGAAGG - Exonic
1055421867 9:76151597-76151619 TTTAGTTAGGTGGAGGACGAAGG - Intronic
1055541858 9:77316902-77316924 TAGAGTTATGAAGAGGAGGAAGG - Intronic
1055693458 9:78858226-78858248 GGGAATTAGGTGGAAGAGGAGGG + Intergenic
1055723123 9:79197909-79197931 CAGGATGAGGAGGAGGAGGAAGG - Intergenic
1056342694 9:85653229-85653251 AGGAAGGAGGAGGAGGAGGAAGG + Intronic
1056704594 9:88941239-88941261 TAGAATTAGGAGAAGGAAAAAGG - Intergenic
1057114108 9:92504303-92504325 TGGAAATAGGAAGAAGAGGAAGG + Intronic
1057565644 9:96164071-96164093 ATGAATTAGGAAGAGGAGCGGGG + Intergenic
1058561444 9:106233184-106233206 AGGAATGAGGAGGAGGAAGAAGG - Intergenic
1058913285 9:109541023-109541045 GAGAAGGAGGAGGAGGAGGAAGG - Intergenic
1059072451 9:111152917-111152939 AGGAAGGAGGAGGAGGAGGAAGG + Intergenic
1059072458 9:111152943-111152965 AGGAAGCAGGAGGAGGAGGAAGG + Intergenic
1059072463 9:111152959-111152981 AGGAAGGAGGAGGAGGAGGAAGG + Intergenic
1059072476 9:111153001-111153023 AGGAAGGAGGAGGAGGAGGAAGG + Intergenic
1059509152 9:114827897-114827919 TTGGAGTAGGAGGAGGATAAGGG - Intergenic
1059592777 9:115679956-115679978 AAGAAGGAGGAGGAGGAGGAAGG - Intergenic
1059712408 9:116881125-116881147 GTGGAAGAGGAGGAGGAGGAAGG + Intronic
1059737722 9:117118895-117118917 TAGAGTGAGGAGGTGGAGGAAGG - Intronic
1059823221 9:117997235-117997257 AGGAAGGAGGAGGAGGAGGAAGG - Intergenic
1060533020 9:124359696-124359718 TAAATTTAAGAGGAGGAGGATGG + Intronic
1061237522 9:129351460-129351482 ATGAATTAGGAGGATGGAGAAGG + Intergenic
1061346578 9:130031047-130031069 TTGAAGTGGGAGGAGGCAGAGGG + Intronic
1061645385 9:131996751-131996773 TAGAGTAAGGAGGAGGAGGTTGG - Intronic
1062451926 9:136619375-136619397 CTGAAGGAGGAGGAGGAAGAGGG + Intergenic
1062744610 9:138203433-138203455 GAGAATTAGGAAGAGGAGGAGGG + Intergenic
1203609704 Un_KI270748v1:85849-85871 TGGAAAGAGGAGGAGGAGGACGG + Intergenic
1185506397 X:634650-634672 GTGAAGTCGGAGGACGAGGACGG + Exonic
1185954860 X:4478252-4478274 GAGAAGAAGGAGGAGGAGGAGGG + Intergenic
1185982750 X:4797915-4797937 GTGATTTAGGAGGATGAAGAGGG + Intergenic
1186828364 X:13364516-13364538 TTGAGCTAGGATGATGAGGATGG - Intergenic
1186894561 X:13992905-13992927 TTGGACTAGGAGGAGGTGGTGGG + Intergenic
1186918013 X:14244489-14244511 TGCAATTAGGAGGAGGATCAAGG - Intergenic
1187025747 X:15433932-15433954 AGGAAGAAGGAGGAGGAGGAAGG + Intronic
1187259697 X:17673867-17673889 TTGAAGTAGGAGGAGGGTTAAGG - Intronic
1187850095 X:23583194-23583216 TTTAATTATGAGGCAGAGGAGGG - Intergenic
1187956690 X:24525520-24525542 TTGGGTCATGAGGAGGAGGAAGG + Intronic
1188065645 X:25656329-25656351 CTGGGTTAGGAGGTGGAGGAGGG - Intergenic
1188390014 X:29608528-29608550 TTAAAATAAGAGGAGGAGGCCGG + Intronic
1188418145 X:29962694-29962716 TTTATTTGGGAGGAGGAGAATGG + Intergenic
1188562997 X:31491227-31491249 TTGGATTTGGGGTAGGAGGAAGG + Intronic
1189156498 X:38762512-38762534 TTGAATTGGGAGGCTGAGGCAGG + Intergenic
1189197072 X:39161922-39161944 GAGAAAGAGGAGGAGGAGGAGGG - Intergenic
1189648381 X:43159606-43159628 TTAAATTAGGAAGGAGAGGAAGG - Intergenic
1192106013 X:68317664-68317686 AGGAAGGAGGAGGAGGAGGAAGG + Intronic
1192182404 X:68924424-68924446 TGGAAGTAGGAGGAGAGGGAAGG - Intergenic
1192343506 X:70282442-70282464 TTGGAGTTGGAGGAGGAGGGAGG + Intronic
1195086493 X:101418509-101418531 TCCCATTAGGAGGAGGGGGAGGG + Intronic
1195302046 X:103539554-103539576 TTGAATTTGAAGGAGGGGTAGGG - Intergenic
1195720436 X:107862149-107862171 TAGCAGGAGGAGGAGGAGGAGGG + Intronic
1196856463 X:119989959-119989981 GAGAAGCAGGAGGAGGAGGATGG + Intergenic
1196859545 X:120014678-120014700 TTGACTTTGGAGGAGAGGGAAGG + Intergenic
1197664839 X:129212410-129212432 AAGAATTATGAGGAAGAGGAAGG + Intergenic
1197954478 X:131931258-131931280 TAGAATTAGGAGAAGGAAAAAGG - Intergenic
1198201037 X:134419021-134419043 TTGTTTTTTGAGGAGGAGGAAGG + Intronic
1198724462 X:139662788-139662810 GTGAATTTGGAGAAGGGGGAGGG - Intronic
1199109932 X:143919749-143919771 AAGAAGGAGGAGGAGGAGGAGGG + Intergenic
1199503151 X:148531519-148531541 ATGAAGTAGAAGGAGGAGCATGG + Intronic
1199860751 X:151798743-151798765 TGGAATTAGGAGGGAGAGAAAGG + Intergenic
1200002335 X:153068512-153068534 TAGGAGGAGGAGGAGGAGGAGGG + Intergenic
1200005389 X:153081498-153081520 TAGGAGGAGGAGGAGGAGGAGGG - Intergenic
1200152540 X:153958350-153958372 TGGGAGCAGGAGGAGGAGGAAGG - Intronic
1201724004 Y:17134344-17134366 TAGAATTAGGAGAAGGAAAATGG - Intergenic