ID: 1074332940

View in Genome Browser
Species Human (GRCh38)
Location 10:112537808-112537830
Sequence GCAGATAGAAATTTTAAAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1229
Summary {0: 1, 1: 0, 2: 1, 3: 65, 4: 1162}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074332940_1074332942 -2 Left 1074332940 10:112537808-112537830 CCTGTTTTAAAATTTCTATCTGC 0: 1
1: 0
2: 1
3: 65
4: 1162
Right 1074332942 10:112537829-112537851 GCAAGAATCAAAGGAGCAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074332940 Original CRISPR GCAGATAGAAATTTTAAAAC AGG (reversed) Intronic
900016615 1:154984-155006 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
900046876 1:513576-513598 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
900069080 1:755294-755316 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
900936079 1:5766963-5766985 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
900939625 1:5790132-5790154 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
902059754 1:13632202-13632224 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
902964612 1:19990591-19990613 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
903611775 1:24620115-24620137 GTAGAAAAAAATTATAAAACAGG - Intergenic
904214364 1:28907534-28907556 GAAGATTGAAATTGTAAAAGTGG + Intronic
904883287 1:33716586-33716608 ACAGATAGACATTTGCAAACTGG - Intronic
906094452 1:43211867-43211889 GCACATATAAATTTGTAAACTGG - Intronic
906183396 1:43840693-43840715 AAAGAGAGAAATTTTAAAGCTGG - Intronic
906352628 1:45077325-45077347 AAAGAGAGAAATTTTAAAGCTGG + Intronic
906410802 1:45577368-45577390 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
906448888 1:45927006-45927028 AAAGAGAGAAATTTTAAAGCTGG + Intronic
906623834 1:47308273-47308295 AAAGAGAGAAATTTTAAAGCTGG - Intronic
906840534 1:49134037-49134059 AAAGAGAGAAATTTTAAAGCTGG + Intronic
906869910 1:49466735-49466757 GCAGCATGAATTTTTAAAACTGG + Intronic
907506677 1:54924132-54924154 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
908019780 1:59887647-59887669 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
908045240 1:60161617-60161639 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
909010809 1:70332763-70332785 GCTGAAATACATTTTAAAACAGG + Intronic
909088427 1:71195302-71195324 GCAAAAGAAAATTTTAAAACAGG - Intergenic
909136391 1:71805425-71805447 AAAGAGAGAAATTTTAAAACTGG - Intronic
909254973 1:73408276-73408298 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
909464853 1:75961595-75961617 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
909556506 1:76960216-76960238 AAAGAGAGAAATTTTAAAGCTGG + Intronic
909577312 1:77188745-77188767 AAAGAGAGAAATTTTAAAGCTGG - Intronic
909749320 1:79138679-79138701 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
909812847 1:79953283-79953305 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
910162421 1:84287983-84288005 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
910605641 1:89080625-89080647 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
910712629 1:90197431-90197453 ACAGAAAAAAATTTTAAAAAAGG - Intergenic
910833481 1:91483894-91483916 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
911083006 1:93951774-93951796 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
911138669 1:94472210-94472232 GCAGCTATAAATTTAAAAAATGG - Intronic
911153603 1:94618648-94618670 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
911893728 1:103403532-103403554 AAAGACAGAAATTTTAAAGCTGG - Intergenic
911896048 1:103436480-103436502 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
911940747 1:104044616-104044638 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
911969406 1:104411439-104411461 TCAAATAGAAATATTACAACTGG - Intergenic
912007798 1:104925954-104925976 GCATATAGAAATTATAAAAGTGG - Intergenic
912010123 1:104948623-104948645 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
912097390 1:106161947-106161969 AAAGAAAGAAATTTTAAAGCTGG - Intergenic
912303510 1:108540921-108540943 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
912807211 1:112766594-112766616 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
912854931 1:113159196-113159218 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
913122729 1:115756639-115756661 AAAGTTATAAATTTTAAAACGGG - Intronic
913268014 1:117064124-117064146 AAAGACAAAAATTTTAAAACAGG - Intronic
913355947 1:117922561-117922583 AAAGAGAGAAATTTTAAAGCTGG + Intronic
915071859 1:153276198-153276220 GCAGACACAAAGTTTAAAAAGGG - Intergenic
915448460 1:155988558-155988580 AAAGAGAGAAATTTTAAAGCTGG - Intronic
915749536 1:158193211-158193233 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
915999470 1:160600908-160600930 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
916318957 1:163481122-163481144 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
916626866 1:166567590-166567612 AAAGACAGAAATTTTAAAGCTGG + Intergenic
916759090 1:167800695-167800717 TCAGATGGAAATTTGAAATCAGG + Intergenic
917168338 1:172139839-172139861 GCAGATATAAAATTTAATTCTGG + Intronic
917188599 1:172389334-172389356 ACACATAGAAATTTTAATATAGG + Intronic
917278108 1:173352435-173352457 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
917313000 1:173696172-173696194 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
917804081 1:178597978-178598000 GCAGCTACCAATTTTAAAAAGGG - Intergenic
917821118 1:178765314-178765336 GAAGAGAGAAATTTTAAAGCTGG + Intronic
918126835 1:181591483-181591505 GAAGATAAAAATTTGAAACCAGG - Intronic
918451992 1:184667982-184668004 GCAGATACAAAGTTTAAAAAGGG - Intergenic
918532516 1:185538904-185538926 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
918818065 1:189216429-189216451 CCTCATAGAAATTTTTAAACAGG + Intergenic
918943910 1:191035852-191035874 GCAAATAGTCATTTTAAGACAGG + Intergenic
918950671 1:191132555-191132577 GCAGATAAAAATATTACATCTGG + Intergenic
919025643 1:192165558-192165580 AAAGAGAGAAATTTTAAAGCTGG - Intronic
919071571 1:192762414-192762436 GCTGTTAGAAATTTGAAAAGAGG - Intergenic
919189939 1:194203594-194203616 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
919296066 1:195702281-195702303 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
919318514 1:196004361-196004383 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
919383326 1:196886396-196886418 AAAGAGAGAAATTTTAAAGCTGG + Intronic
919827305 1:201512388-201512410 GGAGAAAGAGATTTTAAAGCAGG - Intergenic
920062266 1:203235483-203235505 AAAGAGAGAAATTTTAAAGCTGG - Intronic
921137689 1:212276522-212276544 GCAGCTAGGTATTTTAAGACAGG + Intergenic
921896938 1:220411593-220411615 AAAGAGAGAAATTTTAAAACTGG + Intergenic
922104440 1:222500687-222500709 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
922201063 1:223401789-223401811 ACAAAAAGAAATTTTAAAAAGGG + Intergenic
922264760 1:223973201-223973223 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
922376278 1:224970585-224970607 AAAGAGAGAAATTTTAAAGCTGG - Intronic
922638710 1:227204735-227204757 GCCAAGAGAAATTTCAAAACAGG - Intronic
922694658 1:227723233-227723255 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
922888928 1:229045749-229045771 GCAGATAGAAAGTTGAAAGGGGG + Intergenic
922967964 1:229707667-229707689 AAAGAAAGAAATTTTAAAGCTGG - Intergenic
923872616 1:238012462-238012484 GCAGCAAGAAATTGCAAAACAGG - Intergenic
924120234 1:240789983-240790005 AAAGAGAGAAATTTTAAAGCTGG - Intronic
924122369 1:240814169-240814191 GTATATAAAAATTTTAAAAAGGG + Intronic
924128984 1:240885896-240885918 TAAGATAAAAGTTTTAAAACAGG + Intronic
924215980 1:241823034-241823056 GCAAAGAGAAAATTAAAAACAGG + Intergenic
924346619 1:243078205-243078227 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
924358998 1:243215884-243215906 AAAGAGAGAAATTTTAAAGCTGG - Intronic
924489971 1:244526836-244526858 AAAGAGAGAAATTTTAAAGCTGG + Intronic
924524312 1:244833310-244833332 GAAAATAAAAATTTTAAAATAGG + Intergenic
924869670 1:248027557-248027579 AAAGAGAGAAATTTTAAAGCTGG - Intronic
1063703082 10:8404421-8404443 GCATTCAGAAATTTTAAAACAGG - Intergenic
1063798763 10:9545865-9545887 GCTCACAGAAATATTAAAACAGG + Intergenic
1063858932 10:10287686-10287708 TTACATAGAAGTTTTAAAACTGG + Intergenic
1064485872 10:15789148-15789170 GCAGATATAGATTTTTAAAAAGG + Intronic
1064671183 10:17715718-17715740 ATGGATAGAAATTTTTAAACTGG + Exonic
1065034077 10:21620228-21620250 GAACATAAAAATTTTAAAAGAGG - Intronic
1065125064 10:22566241-22566263 AAAGAGAGAAATTTTAAAGCTGG - Intronic
1065432559 10:25674208-25674230 GAAGAGAGAAATTTTAAAGCTGG - Intergenic
1065512420 10:26492589-26492611 AAAGAGAGAAATTTTAAAGCTGG + Intronic
1065671245 10:28120471-28120493 AAACATAGTAATTTTAAAACTGG + Intronic
1065705502 10:28468597-28468619 GCTGAAAGAAGTTATAAAACTGG - Intergenic
1065936263 10:30523102-30523124 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1066331450 10:34427741-34427763 AAAGAGAGAAATTTTAAAGCTGG - Intronic
1066592574 10:37011392-37011414 GCAGAGATAAAAGTTAAAACAGG + Intergenic
1066621337 10:37354461-37354483 AAAGAGAGAAATTTTAAAGCTGG - Intronic
1066642306 10:37566828-37566850 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1066664027 10:37764613-37764635 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1066729732 10:38426644-38426666 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1067109005 10:43385514-43385536 GTAGATAGCAATTTGAAAATGGG + Intergenic
1067303010 10:45031696-45031718 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1067366338 10:45632814-45632836 CCAGCTTGAAATTTTAAAACAGG - Intronic
1067403491 10:45999424-45999446 AAAGAGAGAAATTTTAAAGCTGG + Intronic
1067542996 10:47170080-47170102 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1068290808 10:54999815-54999837 AAAGAGAGAAATTTTAAAGCTGG + Intronic
1068396557 10:56469522-56469544 CTAGATAAAAATTTTAAAAAAGG + Intergenic
1068515680 10:58022386-58022408 AAAGAGAGAAATTTTAAAACTGG - Intergenic
1068662536 10:59637421-59637443 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1068837745 10:61572612-61572634 ACAGATAGAAATTTTACTACAGG - Intergenic
1069132828 10:64727762-64727784 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1069185223 10:65414192-65414214 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1069650285 10:70042344-70042366 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1070050376 10:72882905-72882927 AAAGAGAGAAATTTTAAAGCTGG - Intronic
1070107446 10:73448417-73448439 AAAGAATGAAATTTTAAAACAGG + Intronic
1070314778 10:75299690-75299712 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1070582973 10:77737198-77737220 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1071049510 10:81429590-81429612 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1071183958 10:83019361-83019383 GAAGAGAGAAATTTTAAAGCTGG - Intergenic
1071189404 10:83082239-83082261 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1071588952 10:86853638-86853660 AAAGAGAGAAATTTTAAAGCTGG + Intronic
1071945494 10:90639096-90639118 AAAGAGACAAATTTTAAAACTGG - Intergenic
1072387243 10:94943521-94943543 AAAGAGAGAAATTTTAAAGCTGG + Intronic
1072473116 10:95732709-95732731 AAAGAGAGAAATTTTAAAGCTGG + Intronic
1072498369 10:95986248-95986270 AAAGAGAGAAATTTTAAAGCTGG - Intronic
1072515082 10:96173404-96173426 GTAGGTTGAAATTTTAAAAATGG + Intronic
1072588526 10:96804685-96804707 GAAGATGGAAATTATAAAAGTGG - Intergenic
1073148096 10:101293294-101293316 GCAGATAGATAATTGAAAAATGG + Intergenic
1073678637 10:105678148-105678170 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1073965119 10:108979810-108979832 CCAAATTGAAATTTTAAATCAGG + Intergenic
1074271419 10:111957426-111957448 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1074332940 10:112537808-112537830 GCAGATAGAAATTTTAAAACAGG - Intronic
1074646582 10:115459853-115459875 AAAGAGAGAAATTTTAAAGCTGG - Intronic
1074983776 10:118640103-118640125 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1075166180 10:120070195-120070217 GCAGACAGGAATTTACAAACAGG - Intergenic
1075997657 10:126891599-126891621 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1076573121 10:131445486-131445508 GCAGACAGAGCTTTTGAAACTGG + Intergenic
1076973206 11:150053-150075 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1077851369 11:6077018-6077040 CAAGAGAGAAATTTTAAAGCTGG - Intergenic
1077954158 11:6995510-6995532 TCAGAAATTAATTTTAAAACTGG - Intergenic
1077954231 11:6996385-6996407 CCACATAAAAATTTTTAAACTGG - Intergenic
1078839266 11:15063061-15063083 AAAGAGAGAAATTTTAAAGCTGG + Intronic
1078840000 11:15069559-15069581 AAAGAGAGAAATTTTAAAGCTGG + Intronic
1079511958 11:21221576-21221598 GCAGAAAGAAATAGGAAAACTGG - Intronic
1079586055 11:22127968-22127990 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1080349899 11:31371464-31371486 AGAGATAGAAACTTTAAAAAAGG - Intronic
1081009874 11:37797848-37797870 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1081186362 11:40047220-40047242 ACAGATACAATTTTTAAAAATGG + Intergenic
1081461191 11:43274298-43274320 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1082019876 11:47523171-47523193 GAAGTTATAAATTTTAAAAAAGG + Intronic
1082251775 11:49990325-49990347 ACAGATAGAAATTATAAAAAAGG - Intergenic
1082296637 11:50447880-50447902 AAAGAGAGAAATTTTAAACCTGG - Intergenic
1082300102 11:50494658-50494680 CAAGAGAGAAATTTTAAAGCTGG + Intergenic
1082309464 11:50629600-50629622 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1082310197 11:50636598-50636620 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1082572350 11:54759188-54759210 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1082780242 11:57281862-57281884 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1082919242 11:58474217-58474239 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1083068158 11:59946782-59946804 GGAGAGAGACATCTTAAAACAGG + Intergenic
1083092810 11:60218504-60218526 AAAGAGAGAAATTTTAAAGCTGG - Intronic
1083981859 11:66177990-66178012 GCAGATCTAAATATTAAAAATGG - Intronic
1084097964 11:66924925-66924947 AAAGAGAGAAATTTTAAAGCTGG + Intronic
1085131664 11:74044549-74044571 ATAAATAAAAATTTTAAAACTGG - Intronic
1085959421 11:81443206-81443228 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1086261828 11:84949114-84949136 AAAGAGAGAAATTTTAAAGCTGG + Intronic
1086439843 11:86817412-86817434 GCAGATAGAACTTTTCTAAATGG + Intronic
1086830806 11:91560827-91560849 TCAAATAGAAATATTAAAATAGG + Intergenic
1087344014 11:96947225-96947247 ACAAATAGAAATTCTATAACAGG - Intergenic
1087394098 11:97574325-97574347 CAAGAGAGAAATTTTAAAGCTGG - Intergenic
1087410488 11:97784975-97784997 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1087785429 11:102348337-102348359 ACAGATGGAAATTTTCACACAGG - Intronic
1088008741 11:104973500-104973522 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1088195583 11:107270172-107270194 GGAGATAGAATTTTGAAAACAGG - Intergenic
1088380505 11:109187652-109187674 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1088458086 11:110053644-110053666 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1088475419 11:110233136-110233158 GAATATAGAAGTTTTAATACTGG - Intronic
1088494727 11:110421459-110421481 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1088940658 11:114452283-114452305 GGAGTTAAAAATTTTTAAACTGG - Intergenic
1088967207 11:114735946-114735968 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1089858695 11:121569919-121569941 AAAGAGAGAAATTTTAAAGCTGG - Intronic
1090222926 11:125046253-125046275 AAAGACAGAAATTTTAAAGCTGG - Intergenic
1092414535 12:8280156-8280178 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1092491896 12:8953089-8953111 GCAGATACAAACTATAACACAGG - Intronic
1092678144 12:10945379-10945401 AAAGAGAGAAATTTTAAAGCTGG + Intronic
1093074680 12:14745733-14745755 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1093112202 12:15165654-15165676 GCAGAATGAAGTTTTAAAATGGG + Intronic
1093791088 12:23251006-23251028 GCAGAAAGGAATTGTAAAAAAGG - Intergenic
1094328645 12:29268782-29268804 AAAGAGAGAAATTTTAAAGCTGG + Intronic
1094377060 12:29801614-29801636 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1094385018 12:29884868-29884890 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1094411794 12:30174620-30174642 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1094416626 12:30222920-30222942 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1094720324 12:33056295-33056317 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1094733294 12:33202808-33202830 GCAGAGAAATAGTTTAAAACGGG - Intergenic
1094790399 12:33906557-33906579 TTAGATACAAATCTTAAAACAGG + Intergenic
1094860512 12:34461171-34461193 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1094866009 12:34530640-34530662 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1095341133 12:41089728-41089750 TCATATAGATATTTTAAAAGTGG + Intergenic
1095829671 12:46570554-46570576 ACAAATAAAAATTTTAAAAATGG - Intergenic
1096298796 12:50407484-50407506 GCAAATAAAAGTTTTAAAAGAGG + Intronic
1096402273 12:51317174-51317196 ACAAATAGAAATAATAAAACAGG - Intronic
1096431205 12:51544633-51544655 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1096948731 12:55441037-55441059 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1097497745 12:60363332-60363354 GCAAATATAAATTTTAAAAAGGG - Intergenic
1098333724 12:69380784-69380806 AAAGAGAGAAATTTTAAAGCTGG + Intronic
1098459334 12:70715143-70715165 AAAGAGAGAAATTTTAAAGCTGG + Intronic
1098467871 12:70808504-70808526 AAAGAGAGAAATTTTAAAGCTGG - Intronic
1098508996 12:71289859-71289881 ACAAATAGAAATTATAAAAAAGG - Intronic
1098781114 12:74687687-74687709 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1098960608 12:76736125-76736147 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1099117806 12:78649195-78649217 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1099346792 12:81510431-81510453 GCTGAAATAAATTTTAAAACAGG + Intronic
1099721269 12:86364679-86364701 AAAGAGAGAAATTTTAAAGCTGG + Intronic
1099830985 12:87842472-87842494 TCAGATACAAAGTTTAAAAAGGG - Intergenic
1100508936 12:95249477-95249499 GCTGCCAGAAATTTTAAATCTGG + Intronic
1100771865 12:97932249-97932271 GAAAAGAGAAATTTGAAAACAGG - Intergenic
1101500560 12:105300187-105300209 AAAGAGAGAAATTTTAAAGCTGG - Intronic
1101502168 12:105314330-105314352 AAAGAGAGAAATTTTAAAGCTGG - Intronic
1101657041 12:106731617-106731639 GCAGATTTAAATTTTCAAATTGG + Intronic
1101769296 12:107733688-107733710 GCAGCTAGTAAGTTTAAAGCAGG - Exonic
1102307967 12:111820823-111820845 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1103218041 12:119218687-119218709 GAAGACAGAAATTTTAAAGCTGG + Intronic
1103485659 12:121281094-121281116 AAAGAGAGAAATTTTAAAGCTGG - Intronic
1103958182 12:124591207-124591229 GCAGATGGAAATTATCAAAGAGG - Intergenic
1104119074 12:125780913-125780935 TCAGACAGAGATTTTAAAAAAGG - Intergenic
1104189977 12:126471549-126471571 TCAGATAAAAATTCTAGAACTGG + Intergenic
1104693254 12:130842409-130842431 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1105227608 13:18451090-18451112 AAAGATAGAAATTTTAAAGCTGG + Intergenic
1105557069 13:21457646-21457668 GTACAAAGTAATTTTAAAACTGG + Intronic
1105566783 13:21557208-21557230 GCAATTTGAGATTTTAAAACTGG + Intronic
1106400045 13:29421155-29421177 GAAAACAGAAATTTTTAAACTGG - Intronic
1106595818 13:31135470-31135492 GCAGCTAGAAATTATAAAGTAGG + Exonic
1106610872 13:31279418-31279440 AAAGAGAGAAATTTTAAAGCTGG + Intronic
1106739877 13:32629064-32629086 ACAGAGAAAAATTTGAAAACCGG - Intronic
1106746462 13:32713979-32714001 AAAGAGAGAAATTTTAAAGCTGG + Intronic
1107520450 13:41175410-41175432 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1108218273 13:48207045-48207067 AAAGAGAGAAATTTTACAACTGG + Intergenic
1108294691 13:49002030-49002052 AAAGAGAGAAATTTTAAAGCTGG - Intronic
1109081099 13:57902754-57902776 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1109377658 13:61519027-61519049 AAAGACAGAAATTTTAAAGCTGG + Intergenic
1109498409 13:63206506-63206528 GTAGTTATTAATTTTAAAACTGG + Intergenic
1110029802 13:70594996-70595018 GTAGATAGTAAATTTGAAACTGG - Intergenic
1110407405 13:75166351-75166373 GCTGATAACAATTTTAGAACAGG + Intergenic
1110477624 13:75935764-75935786 CCATATAGATAATTTAAAACTGG - Intergenic
1110676098 13:78246784-78246806 GCTAATAGCAATTTTAAAATGGG + Intergenic
1110770820 13:79342813-79342835 GCAGATGTTAATTTCAAAACTGG - Exonic
1110854924 13:80286098-80286120 GCAGATAGAAAATTTAAAAATGG + Intergenic
1111123348 13:83881312-83881334 GCAGAAATAAATGGTAAAACTGG + Exonic
1111130958 13:83974868-83974890 GCAAATAAAAATTTAAAAAGAGG - Intergenic
1111178270 13:84627446-84627468 GCTGATGCAAATTTTAAAACTGG - Intergenic
1111429455 13:88133095-88133117 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1111468239 13:88644912-88644934 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1111509626 13:89243512-89243534 AAAGACAGAAATTTTAAAGCTGG - Intergenic
1111578956 13:90197798-90197820 GCAGAAGGAAAGTTGAAAACAGG - Intergenic
1111684877 13:91489334-91489356 AAAGAGAGAAATTTTAAAGCTGG - Intronic
1111712076 13:91829715-91829737 AAAGAGAGAAATTTTAAAGCTGG + Intronic
1111825475 13:93262314-93262336 GGAGAGAGCAATTTTAAAAATGG + Intronic
1112093597 13:96108604-96108626 AAAGAGAGAAATTTTAAAGCTGG - Intronic
1112317175 13:98373301-98373323 TCAGAATGTAATTTTAAAACAGG + Intronic
1112449281 13:99494357-99494379 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1112691423 13:101899433-101899455 TCAAATGGAAGTTTTAAAACTGG + Intronic
1112767803 13:102763859-102763881 GCAGATAGAAAATTGAAAGTTGG + Intergenic
1112960522 13:105120105-105120127 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1113873410 13:113578905-113578927 GCAGAGTGATATTTTAAAATTGG - Intergenic
1114144314 14:19955598-19955620 AAAGACAGAAATTTTAAAGCTGG - Intergenic
1114157238 14:20118600-20118622 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1114215436 14:20654446-20654468 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1114339685 14:21730209-21730231 AAAGAGAGAAATTTTAAAACTGG + Intergenic
1114355588 14:21904285-21904307 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1114426832 14:22630922-22630944 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1114638506 14:24202922-24202944 AAAGAGAGAAATTTTAAAGCTGG - Intronic
1114687179 14:24544134-24544156 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1114892378 14:26941948-26941970 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1115170672 14:30502508-30502530 GCATTTAAAAAATTTAAAACTGG + Intergenic
1115779476 14:36753422-36753444 GGAGAGAGAAAATTTAAAAATGG + Intronic
1115884751 14:37958768-37958790 AAAGAGAGAAATTTTAAAGCTGG - Intronic
1115903329 14:38179049-38179071 GCCGAAAGAAACTGTAAAACTGG + Intergenic
1115958746 14:38810809-38810831 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1116089255 14:40284083-40284105 GGAAATGTAAATTTTAAAACTGG + Intergenic
1116181332 14:41540484-41540506 AAAGAAAGAAATTTTAAAGCTGG + Intergenic
1116184436 14:41578779-41578801 AGAGATAAAAATTTTAAAAATGG + Intergenic
1116227898 14:42176032-42176054 GCAGAAAGAAATTATAAAAATGG + Intergenic
1116301741 14:43192099-43192121 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1116344254 14:43770448-43770470 GCAGACAGAATTTTTAAAAGGGG - Intergenic
1116562795 14:46402598-46402620 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1116795812 14:49389124-49389146 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1116832867 14:49739615-49739637 GCAGATAGTAATAAGAAAACTGG + Intronic
1116978064 14:51137913-51137935 GAAGAAATAAATTTTAAAAGAGG + Intergenic
1117276464 14:54198888-54198910 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1117382101 14:55174571-55174593 ACAAAAAGAAATTTTAAAGCTGG - Intronic
1117415896 14:55495123-55495145 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1118080950 14:62360139-62360161 TCAGATACAAGTTTCAAAACAGG - Intergenic
1118372144 14:65146430-65146452 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1118376122 14:65178730-65178752 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1118640060 14:67783580-67783602 GCATAAAGAAATTGTAAGACTGG - Intronic
1118947688 14:70402928-70402950 GCAGCTAGAAATTTTTACAATGG + Intronic
1119573304 14:75695603-75695625 AAAGAGAGAAATTTTAAAGCTGG - Intronic
1119959789 14:78842302-78842324 AAAGAGAGAAATTTTAAAGCTGG + Intronic
1119985370 14:79131530-79131552 GCAGCTAGAGATCTGAAAACGGG - Intronic
1120238671 14:81923692-81923714 ACAGTAAAAAATTTTAAAACAGG - Intergenic
1120658182 14:87220939-87220961 GCAGATAAAGATTATATAACCGG + Intergenic
1120807338 14:88766809-88766831 AAAGAGAGAAATTTTAAAGCTGG - Intronic
1121099395 14:91239834-91239856 AAAGAGAGAAATTTTAAAGCTGG + Intronic
1121808927 14:96861651-96861673 GGAGATAGGAATTTTGAAATTGG + Intronic
1123103348 14:105820669-105820691 ACAGATACAAAGTTTAAAAAGGG + Intergenic
1123212928 14:106778022-106778044 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1123845514 15:24297242-24297264 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1123849009 15:24334765-24334787 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1123864558 15:24505032-24505054 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1123931536 15:25173966-25173988 AAAGAAAGAAATTTTAAAGCTGG + Intergenic
1124248151 15:28088591-28088613 AAAGAGAGAAATTTTAAAGCTGG + Intronic
1124267789 15:28252832-28252854 GCACAGTGAAATTTTGAAACAGG - Intronic
1125567274 15:40686154-40686176 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1126142958 15:45452505-45452527 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1126193636 15:45905541-45905563 ACAGATACAAAGTTTAAAAAGGG + Intergenic
1126276120 15:46883653-46883675 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1126306115 15:47260029-47260051 CCAAATAGAAATTATAGAACTGG - Intronic
1126519013 15:49568482-49568504 GCAGACCCAAATTTTAACACTGG + Intronic
1126619236 15:50620421-50620443 GCATATATAAATGTTAAATCAGG - Intronic
1127072248 15:55298328-55298350 AAAGAGAGAAATTTTAAAGCTGG + Intronic
1127755059 15:62084150-62084172 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1127777763 15:62280970-62280992 GTATATAGAATTTTTAAAAAAGG - Intergenic
1128477234 15:68007648-68007670 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1128598751 15:68977211-68977233 AAAGAGAGAAATTTTAAAGCTGG + Intronic
1128742378 15:70092889-70092911 GCTGCTATAAATTTTAAACCTGG + Intronic
1129064824 15:72893273-72893295 GCAAATAGAAAAATTAAGACAGG - Intergenic
1129218712 15:74118148-74118170 AAAGAGAGAAATTTTAAAGCTGG + Intronic
1129969114 15:79761834-79761856 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1130306772 15:82717155-82717177 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1130757245 15:86778046-86778068 AAAGAGAGAAATTTTAAAGCTGG + Intronic
1131015604 15:89055245-89055267 AAAGATAGACACTTTAAAACTGG - Intergenic
1131022177 15:89108200-89108222 GAAGCTAGAAGTTTGAAAACAGG + Intronic
1131589741 15:93735567-93735589 AAAGACAGAAATTTTAAAGCTGG - Intergenic
1131723358 15:95196014-95196036 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1132166586 15:99597716-99597738 AAAGAGAGAAATTTTAAAGCTGG - Intronic
1132213769 15:100047481-100047503 AAAGAGAGAAATTTTAAAGCTGG - Intronic
1133162118 16:3919001-3919023 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1133707381 16:8367836-8367858 ACAGAAAGAAATATAAAAACTGG + Intergenic
1134397657 16:13880060-13880082 ACAATTAGAAATTTTAAAAGGGG + Intergenic
1134406520 16:13964272-13964294 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1135290288 16:21230597-21230619 GCACTTTGAAATTTAAAAACAGG - Intergenic
1135301190 16:21328850-21328872 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1135813460 16:25610671-25610693 AAAGAGAGAAATTTTAAAGCCGG + Intergenic
1135871250 16:26152553-26152575 GCAGATACATATTGTAAAGCAGG - Intergenic
1136595376 16:31245446-31245468 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1136635311 16:31517707-31517729 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1136642552 16:31579034-31579056 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1137303422 16:47176583-47176605 GCAGCTAGAAAATTAGAAACAGG - Intronic
1137414619 16:48263888-48263910 AAAGAGAGAAATTTTAAAGCTGG + Intronic
1138321463 16:56116957-56116979 GCAGGAACAAAGTTTAAAACAGG + Intergenic
1138500558 16:57440510-57440532 AAAGAGAGAAATTTTAAAGCTGG - Intronic
1138988982 16:62367426-62367448 ACAGATAGAAATTATAACTCTGG + Intergenic
1139497940 16:67334815-67334837 AAAGAGAGAAATTTTAAAGCTGG + Intronic
1139727679 16:68914666-68914688 ACATATATAAATTTTAGAACAGG + Intronic
1140670899 16:77277932-77277954 GCAAATAGACTTTTTAAAACTGG - Intronic
1140867233 16:79073865-79073887 CCAGGTAGTAATTTTAAAATGGG + Intronic
1141751148 16:85959020-85959042 GCTGGTAGAAATTTAACAACTGG + Intergenic
1141800506 16:86304900-86304922 ACATATATATATTTTAAAACAGG - Intergenic
1141960770 16:87406249-87406271 GAAAATAAAAATTTTAAAAAAGG - Exonic
1142447045 16:90147473-90147495 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1142460447 17:87858-87880 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1143694638 17:8603255-8603277 GCTGATAAAAATATTAAAAGGGG + Intronic
1143936045 17:10485058-10485080 TGAGAGAGAAATTTTAAAGCTGG + Intergenic
1143941052 17:10541743-10541765 AAAGAGAGAAATTTTAAAGCTGG - Intronic
1144324979 17:14170221-14170243 GCAGATTCAACTTGTAAAACGGG - Intronic
1145387485 17:22426421-22426443 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1145819609 17:27821908-27821930 AAAGAGAGAAATTTTAAAGCTGG + Intronic
1145869594 17:28262687-28262709 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1146731894 17:35200181-35200203 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1147059000 17:37858957-37858979 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1147482972 17:40784585-40784607 TCAGTTAGAAATATTAAAATAGG - Intergenic
1147591441 17:41686300-41686322 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1148177573 17:45580987-45581009 GAAGAAAAAAATTTTAGAACTGG - Intergenic
1148989552 17:51653545-51653567 GGAGTTAGAAATATTAAAAGGGG - Intronic
1149028239 17:52054660-52054682 AAAGAGAGAAATTTTAAAGCTGG - Intronic
1149414911 17:56449036-56449058 ACATAGTGAAATTTTAAAACAGG - Intronic
1149827960 17:59846932-59846954 GCAGTTAGGGATTTGAAAACAGG + Intergenic
1150358800 17:64510939-64510961 AAAGAGAGAAATTTTAAAGCTGG + Intronic
1150447409 17:65237726-65237748 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1150785879 17:68162352-68162374 GCAGAAAGAAAGTTTACAAGGGG + Intergenic
1150839937 17:68598420-68598442 GCACTTATAAATGTTAAAACTGG - Intronic
1151393504 17:73803833-73803855 ACTGCTGGAAATTTTAAAACAGG - Intergenic
1151591053 17:75045077-75045099 AAAGAGAGAAATTTTAAAGCTGG + Intronic
1151864635 17:76792868-76792890 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1153073556 18:1134554-1134576 GAAAATAGAATTTTAAAAACAGG - Intergenic
1153587392 18:6637143-6637165 GAAGCTAAAAATTCTAAAACTGG - Intergenic
1153795949 18:8622396-8622418 AAAGAGAGAAATTTTAAAGCTGG + Intronic
1154047688 18:10922240-10922262 AAAGAGAGAAATTTTAAAGCTGG - Intronic
1154107571 18:11536064-11536086 AAAGAGAGAAATTTTAAAGCGGG + Intergenic
1154107588 18:11536187-11536209 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1154525774 18:15288386-15288408 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1156173611 18:34516153-34516175 CAAGAGAGAAATTTTAAAGCTGG + Intronic
1156273951 18:35563388-35563410 GTATATAGAAATTTAAAAAGGGG + Intergenic
1156649865 18:39213011-39213033 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1156868060 18:41910754-41910776 GCAGATAAAAAAATCAAAACAGG - Intergenic
1156883950 18:42112537-42112559 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1157467695 18:47961567-47961589 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1158854000 18:61524269-61524291 ATAGATAAAAATTTTAACACTGG + Intronic
1158882354 18:61792818-61792840 ACAAACAGAAATTTTAAGACAGG - Intergenic
1159074613 18:63666256-63666278 AAAGAGAGAAATTTTAAAGCTGG - Intronic
1159078981 18:63714126-63714148 ACAGAGAGAAATTTTAAAGCTGG + Intronic
1159280190 18:66274850-66274872 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1159425887 18:68285639-68285661 ACTGATATAAATTTTAAAAATGG + Intergenic
1159537256 18:69729765-69729787 GCAGATAAAAATGTAAAAATGGG + Intronic
1159549399 18:69878943-69878965 AAAGACAGAAATTTTAAAGCTGG + Intronic
1159686247 18:71424245-71424267 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1159869702 18:73746484-73746506 GCAAATACAAATTTTAAAATAGG - Intergenic
1160126490 18:76177423-76177445 ACAGATACAAAGTTTAAAAGGGG + Intergenic
1160547319 18:79668186-79668208 ACAGATACAAAGTTTAAAAAGGG - Intergenic
1160650162 19:220358-220380 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1162275411 19:9649944-9649966 AAAGAGAGAAATTTTAAAGCTGG - Intronic
1162281067 19:9698406-9698428 AAAGAGAGAAATTTTAAAGCTGG - Intronic
1162508771 19:11104416-11104438 AAAGAAAGAAATTTTAAAAAAGG - Intronic
1162784604 19:13026525-13026547 GCGGAAAGAAATTATAAAAAGGG - Intronic
1163239453 19:16051277-16051299 ACAAATAAAAATTTTAAAAAAGG + Intergenic
1164172175 19:22734857-22734879 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1164276038 19:23719554-23719576 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1164365703 19:27579636-27579658 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1164378684 19:27712327-27712349 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1164449049 19:28343928-28343950 GCAGAAACAAATTGTACAACTGG + Intergenic
1165219096 19:34300356-34300378 GCAAATCGAAGTTTTAAAAAAGG - Exonic
1165665468 19:37623676-37623698 AAAGAGAGAAATTTTAAAGCTGG - Intronic
1165695480 19:37897582-37897604 GCTGAGAGATTTTTTAAAACAGG - Intronic
1165812825 19:38622332-38622354 AAAGAGAGAAATTTTAAAGCTGG + Intronic
1166165966 19:40988870-40988892 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1166912109 19:46166253-46166275 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1167818816 19:51907667-51907689 AAAGAGAGAAATTTTAAAGCTGG - Intronic
1168352075 19:55681655-55681677 GCAGAAATAAAGTTTAAAACAGG - Intronic
925350622 2:3198622-3198644 AAAGAGAGAAATTTTAAAGCTGG + Intronic
926135373 2:10332333-10332355 GCAGATGGAACTTTGAAAAAAGG - Intronic
926556265 2:14361977-14361999 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
926816361 2:16801810-16801832 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
926859065 2:17290087-17290109 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
926874128 2:17456559-17456581 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
926909234 2:17835008-17835030 TGAGATTGGAATTTTAAAACTGG + Intergenic
926996021 2:18736671-18736693 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
927195675 2:20544841-20544863 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
928294559 2:30071548-30071570 TCAGGGAGAATTTTTAAAACAGG + Intergenic
928438194 2:31269610-31269632 GCAAAAATAAATTTTAAAAGTGG + Intergenic
928901624 2:36324160-36324182 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
928960377 2:36919771-36919793 ATAGAGAGAAATTTTAAAAATGG + Intronic
929362687 2:41113511-41113533 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
929529557 2:42739202-42739224 AAAGAGAGAAATTTTAAAGCTGG - Intronic
930161896 2:48167035-48167057 AAAGAGAGAAATTTTAAAGCCGG + Intergenic
930408994 2:50999554-50999576 AAAGAGAGAAATTTTAAAGCTGG - Intronic
930489573 2:52051195-52051217 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
930595853 2:53387300-53387322 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
931089080 2:58866490-58866512 GGGGATATAAATTTTAAATCTGG + Intergenic
931470429 2:62533650-62533672 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
931578545 2:63747001-63747023 AAAGAGAGAAATTTTAAAGCTGG - Intronic
932489605 2:72112305-72112327 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
932881821 2:75508789-75508811 AAAGAGAGAAATTTTAAAGCTGG - Intronic
932941931 2:76177236-76177258 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
933069452 2:77838778-77838800 CCATATAGGAATTTTAAAATTGG - Intergenic
933493832 2:83022364-83022386 TGAGATAGACATTTTAAACCTGG - Intergenic
933611264 2:84438279-84438301 GCAGTTTAAAATTTTAAAAGAGG + Intronic
933611806 2:84444318-84444340 AAAGAGAGAAATTTTAAAGCTGG + Intronic
934932258 2:98436171-98436193 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
935018372 2:99206023-99206045 AAAGAGAGAAATTTTAAAGCTGG - Intronic
935409422 2:102744441-102744463 TTAGAAAGAAATTTTAAAATCGG + Intronic
935868327 2:107416601-107416623 GCAGTTCGAATTTTTAACACAGG - Intergenic
936686717 2:114836374-114836396 AAAGAGAGAAATTTTAAAGCTGG + Intronic
937602904 2:123760669-123760691 GTAGATGGAAATTTTAGATCTGG + Intergenic
937613369 2:123890735-123890757 AAAGAGAGAAATTTTAAATCTGG - Intergenic
938308681 2:130270795-130270817 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
938524875 2:132119747-132119769 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
938819323 2:134939154-134939176 GAAGAAAGTTATTTTAAAACAGG + Intronic
938820899 2:134959233-134959255 GCTAATAGAAAATCTAAAACAGG + Exonic
938858614 2:135342158-135342180 AAAGAGAGAAATTTTAAAGCTGG - Intronic
938872848 2:135499154-135499176 AAAGAGAGAAATTTTAAAGCTGG - Intronic
939006992 2:136800502-136800524 GTGGATAGAAAACTTAAAACGGG + Intronic
939246059 2:139625163-139625185 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
939719498 2:145631005-145631027 CCTGATAGAAATTTTAAAATAGG + Intergenic
939908187 2:147945035-147945057 CCATATTGCAATTTTAAAACTGG - Intronic
940152856 2:150622171-150622193 GCAGAGAGAAACTTGAACACTGG - Intergenic
940487217 2:154311336-154311358 AAAGAGAGAAATTTTAAAGCTGG + Intronic
940502693 2:154514045-154514067 GAAGATGCAAATTTTAAATCTGG + Intergenic
940548175 2:155116644-155116666 GGAGATAGAAATTATTAAAAAGG + Intergenic
940948506 2:159645725-159645747 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
941892233 2:170594549-170594571 GCAAATAGGAATTTTACCACAGG + Intronic
942312924 2:174672076-174672098 AAAGAGAGAAATTTTAAAGCTGG - Intronic
942380864 2:175388606-175388628 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
942403445 2:175627945-175627967 ACAGATACAATTTTTAAAAAGGG + Intergenic
942412635 2:175727131-175727153 GGGGATAGGAATTCTAAAACAGG + Intergenic
942478252 2:176352785-176352807 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
943321778 2:186453416-186453438 GCAGACGTAAATTCTAAAACAGG - Intergenic
943460026 2:188161217-188161239 GTAGATACAAATTCTAAAAGAGG - Intergenic
943502723 2:188711995-188712017 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
943524237 2:188996686-188996708 GCAGATAAAAAATATGAAACAGG + Intronic
943606574 2:189983858-189983880 AAAGAGAGAAATTTTAAAGCTGG + Intronic
943750842 2:191507856-191507878 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
944178665 2:196862633-196862655 AAAGAGAGAAATTTTAAAGCTGG - Intronic
944397142 2:199281011-199281033 AAAGAGAGAAATTTTAAAGCTGG - Intronic
944760766 2:202811208-202811230 AAAGAGAGAAATTTTAAAGCTGG - Intronic
945066616 2:205953038-205953060 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
945327519 2:208499642-208499664 GCAGAGATTAATATTAAAACTGG + Intronic
945456698 2:210058923-210058945 AAAGAGAGAAATTTTAAAGCTGG - Intronic
945488271 2:210424555-210424577 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
945488548 2:210427111-210427133 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
945536500 2:211024905-211024927 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
945766957 2:213992501-213992523 ACAGATAATAATTTTAAAAATGG - Intronic
945897265 2:215497696-215497718 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
945919275 2:215738882-215738904 GGAGAGAGGAATTTTAAATCAGG + Intergenic
946423668 2:219579968-219579990 TGAAATAAAAATTTTAAAACAGG - Intergenic
946918134 2:224547923-224547945 ACAAATATAAAATTTAAAACTGG + Intronic
947270385 2:228327770-228327792 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
947276438 2:228397195-228397217 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
947959854 2:234227260-234227282 TCACATAGAACTCTTAAAACTGG - Intergenic
948012911 2:234664316-234664338 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
948621446 2:239237524-239237546 GTAGATACAAGTTTTAAAACAGG + Intronic
1169280658 20:4264223-4264245 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1169613704 20:7414119-7414141 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1169640814 20:7749853-7749875 TCAATTATAAATTTTAAAACTGG + Intergenic
1170354946 20:15481804-15481826 GCAGAAATAAATTCTAAGACAGG + Intronic
1170975271 20:21158131-21158153 ACAAAGACAAATTTTAAAACAGG - Intronic
1171492415 20:25530624-25530646 AAAGAGAGAAATTTTAAAGCTGG + Intronic
1171777484 20:29382588-29382610 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1172264338 20:33597925-33597947 AAAGAGAGAAATTTTAAAGCTGG + Intronic
1172470424 20:35189688-35189710 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1173045640 20:39507599-39507621 TCAGATAGACTTTTTAAATCAGG + Intergenic
1173063758 20:39688865-39688887 GCACAAACAATTTTTAAAACCGG + Intergenic
1173699746 20:45058390-45058412 GCAGGTTGAAGTTTTAAAATTGG - Intronic
1174260888 20:49294270-49294292 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1174467002 20:50725347-50725369 GGAGAAAGAAAATTTAAAATAGG - Intergenic
1176771653 21:13080101-13080123 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1176914684 21:14610643-14610665 CAAGAGAGAAATTTTAAAGCTGG - Intronic
1176979409 21:15363036-15363058 GAAGAAAAAAATTTTAAAAAAGG + Intergenic
1177209650 21:18055016-18055038 GAAGAAAGTAAATTTAAAACAGG - Intronic
1177358140 21:20034868-20034890 GAAGATAGAAAGTATAAAAGTGG + Intergenic
1177527302 21:22311110-22311132 ACAGATACAGATATTAAAACCGG + Intergenic
1177866129 21:26514956-26514978 GAAGATAGAAAAATTATAACTGG + Intronic
1177910605 21:27026288-27026310 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1178385647 21:32147641-32147663 CCAAATAGAAATTCTAGAACTGG + Intergenic
1178836282 21:36100294-36100316 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1179184569 21:39075090-39075112 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1179421951 21:41243450-41243472 CCAGATAGAAATTCTGAAATTGG + Exonic
1179425252 21:41272987-41273009 AAAGAGAGAAATTTTAAAGCTGG + Intronic
1179660989 21:42875027-42875049 AAAGAGAGAAATTTTAAAGCTGG - Intronic
1179950362 21:44705980-44706002 AAAGAGAGAAATTTTAAAGCTGG - Intronic
1180155592 21:45975725-45975747 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1180518782 22:16174548-16174570 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1182689417 22:32147754-32147776 AAAGAGAGAAATTTTAACACTGG - Intergenic
1182894412 22:33847117-33847139 AAAGAGAGAAATTTTAAAGCTGG - Intronic
1183595017 22:38806250-38806272 GCAGAAAAAAATTTTACATCTGG - Intergenic
1183625367 22:38998163-38998185 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1184054353 22:42034316-42034338 AAAGAGAGAAATTTTAAAGCTGG + Intronic
949638949 3:6013826-6013848 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
949787935 3:7762118-7762140 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
950064041 3:10096974-10096996 AAAGAGAGAAATTTTAAAGCTGG + Intronic
950198561 3:11026851-11026873 AAAGAGAGAAATTTTAAAGCTGG + Intronic
950818990 3:15738251-15738273 AAAGAGAGAAATTTTAAAGCTGG + Intronic
951025866 3:17829008-17829030 ATAGATAGTATTTTTAAAACAGG + Intronic
951212277 3:19988724-19988746 AAAGACAGAAATTTTAAAGCTGG - Intronic
951398392 3:22200313-22200335 AAAGAGAGAAATTTTAAAACTGG + Intronic
951486592 3:23219276-23219298 GCTGATAGAAAATGTAAAACTGG + Intronic
951824449 3:26852841-26852863 GGAAATAGAAATTTTAAATGGGG + Intergenic
952456039 3:33472758-33472780 ACAGATACAAAGTTTAAAAATGG + Intergenic
952651423 3:35731792-35731814 GCAGAAAGATACTTTAAAAAGGG - Intronic
952725322 3:36578209-36578231 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
952934089 3:38382050-38382072 AAAGAGAGAAATTTTAAAGCTGG - Intronic
953016739 3:39083994-39084016 GCAGATTGTTATTTTAAAAAAGG + Intronic
953060399 3:39423486-39423508 AATGATAAAAATTTTAAAACGGG + Intergenic
953509289 3:43519077-43519099 AAAGAGAGAAATTTTAAAGCTGG - Intronic
953519654 3:43629122-43629144 AAAGAGAGAAATTTTAAAGCTGG - Intronic
953994063 3:47506049-47506071 AAAGAGAGAAATTTTAAAGCTGG + Intronic
954219218 3:49142514-49142536 AAAGAGATAAATTTTAAAACTGG + Intergenic
954888962 3:53905363-53905385 GTAGATAAAGATTTTAAGACTGG + Intergenic
955270209 3:57490548-57490570 GCAGATAGAAACATTAAAGGTGG - Intronic
956131285 3:66056131-66056153 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
956235085 3:67060656-67060678 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
956362766 3:68466850-68466872 AAAAATAGAAATTTTAAAGCTGG + Intronic
956813963 3:72890867-72890889 ACAGAACAAAATTTTAAAACTGG + Intronic
957119460 3:76070748-76070770 AAAGAGAGAAATTTTAAAGCTGG - Intronic
957373510 3:79326403-79326425 AAAGAGAGAAATTTTAAAGCTGG - Intronic
957469140 3:80636121-80636143 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
957778988 3:84793704-84793726 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
957784790 3:84868367-84868389 GCAGAAAACAATTTTAAAAAAGG + Intergenic
957852548 3:85828352-85828374 TAAAATAGGAATTTTAAAACAGG + Intronic
957874771 3:86131104-86131126 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
957926548 3:86821743-86821765 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
957975491 3:87438186-87438208 GCAGATAAAAATTTTGCAAAAGG - Intergenic
958190934 3:90184170-90184192 GTAAATAGATATATTAAAACAGG + Intergenic
958271277 3:91502333-91502355 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
958413137 3:93843298-93843320 GTAAATAGACATATTAAAACAGG + Intergenic
958509143 3:95022785-95022807 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
958603426 3:96328104-96328126 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
958607722 3:96380479-96380501 TAATATAAAAATTTTAAAACAGG + Intergenic
958625218 3:96614544-96614566 AAAGAGAGAAATTTTAAAACTGG + Intergenic
958722025 3:97855673-97855695 AAAGAGAGAAATTTTAAAGCTGG + Intronic
958752926 3:98213723-98213745 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
958761198 3:98310699-98310721 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
958901280 3:99889527-99889549 AAAGATAAAAATTGTAAAACTGG - Intronic
958998937 3:100939456-100939478 AAAGAGAGAAATTTTAAAGCTGG + Intronic
959050106 3:101516505-101516527 GCAGAATAAAATTTTAAAAAAGG - Intergenic
959126414 3:102294908-102294930 AAAGAGAGAAATTTTAAAGCTGG - Intronic
959265879 3:104138192-104138214 GCACATAAAAATTTTTAAATTGG - Intergenic
959820371 3:110728486-110728508 GTATATTGAAATATTAAAACAGG + Intergenic
959936797 3:112037718-112037740 AAAGAGAGAAATTTTAAAGCTGG - Intronic
959938928 3:112060024-112060046 AAAGAGAGAAATTTTAAAGCTGG + Intronic
960308406 3:116090669-116090691 AAAGAGAGAAATTTTAAAGCTGG + Intronic
960439831 3:117673187-117673209 GCTGAGAGAAATTTACAAACTGG - Intergenic
960541326 3:118865512-118865534 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
960726750 3:120677819-120677841 AAAGAGAGAAATTTTAAAGCCGG - Intronic
961892082 3:130138777-130138799 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
961902818 3:130230540-130230562 ACAGCTAGAAATTTTGAACCAGG - Intergenic
961923613 3:130452419-130452441 AAAGAGAGAAATTTTAAAGCTGG + Intronic
962261672 3:133913459-133913481 GTAAATAAAAATTTTAAAAGTGG + Intergenic
962290350 3:134131150-134131172 AAAGAGAGAAATTTTAAAGCTGG + Intronic
962651606 3:137499298-137499320 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
962667326 3:137668149-137668171 GCAGATATAAATTTCTAAATAGG - Intergenic
962765276 3:138556646-138556668 AAAGAGAGAAATTTTAAAGCTGG + Intronic
963078900 3:141372977-141372999 GCAGCTAGAAATTAGAAATCAGG - Intronic
963257754 3:143162674-143162696 GAAGACAGAAATTTAAAACCTGG + Intergenic
963350847 3:144149363-144149385 GGAGATAGAAATTTTGAAAACGG - Intergenic
963382450 3:144548773-144548795 ACTGATGGAAACTTTAAAACTGG + Intergenic
963412282 3:144945543-144945565 ACAGAGAGAAATTTTAAGACTGG - Intergenic
963414906 3:144983194-144983216 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
963500117 3:146115095-146115117 AAAGAGAGAAATTTTAAAGCTGG - Intronic
963519599 3:146347408-146347430 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
963523445 3:146385595-146385617 GCAAATATAAAGTTTAAAAATGG - Intergenic
963618860 3:147578641-147578663 GCAGATATAATTTTTAATAAAGG - Intergenic
964337386 3:155670199-155670221 GCAAAGAGAAATTATAAAAGAGG + Intronic
964453384 3:156835071-156835093 GGAAATAGAAACTTAAAAACTGG - Intronic
964754426 3:160080938-160080960 AAAGAGAGAAATTTTAAAGCCGG + Intergenic
964840035 3:160983786-160983808 AAAGAGAGAAATTTTAAAGCTGG + Intronic
965282990 3:166777807-166777829 GCAGAAATAAATTATATAACTGG - Intergenic
965357008 3:167688029-167688051 GCAAAGAAAAATTTTAAAATGGG - Intronic
965455533 3:168895109-168895131 CCAAATGGAAATTTTAGAACTGG + Intergenic
965664584 3:171079290-171079312 GTAGATATAAATGTTCAAACTGG + Intronic
965682459 3:171265514-171265536 GCAGACAGAGATTTCAAAACTGG + Intronic
965928874 3:174017614-174017636 AAAGAGAGAAATTTTAAAGCTGG + Intronic
965982138 3:174705997-174706019 GTAGAGAGAAATTATAAAAGTGG - Intronic
966077380 3:175953926-175953948 GGAAATGGATATTTTAAAACTGG + Intergenic
966124907 3:176564271-176564293 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
966142635 3:176772908-176772930 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
966151246 3:176869478-176869500 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
966769789 3:183493496-183493518 GGAGAAAGAAAATTTGAAACTGG + Intronic
966817388 3:183900376-183900398 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
967412725 3:189183155-189183177 AAAGAGAGAAATTTTAAAGCTGG + Intronic
967497903 3:190162525-190162547 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
968025251 3:195436983-195437005 TCATATAGAAATTTAAAAGCTGG - Intronic
968192848 3:196683131-196683153 AAAGAGAGAAATTTTAAAGCCGG + Intronic
968212107 3:196857584-196857606 AAAGAGAGAAATTTTAAAGCCGG + Intergenic
968367685 3:198199771-198199793 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
968421028 4:484983-485005 AAAGAGAGAAATTTTAAAGCTGG - Intronic
969008618 4:4042211-4042233 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
969009282 4:4048190-4048212 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
969273266 4:6117294-6117316 AAAGAGAGAAATTTTAAAGCTGG + Intronic
969745070 4:9064159-9064181 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
970021250 4:11572004-11572026 GCTACTAGAAAATTTAAAACTGG + Intergenic
970056576 4:11980072-11980094 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
970342463 4:15120965-15120987 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
970352818 4:15221707-15221729 GCAGATGCAAATTTTAAAAGAGG + Intergenic
970393833 4:15645040-15645062 GCAGGCAGAAATTTTAAAGAGGG + Intronic
970720673 4:18985168-18985190 CCAGATCGAATTTTGAAAACAGG - Intergenic
970742593 4:19255406-19255428 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
971365874 4:25976777-25976799 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
971899903 4:32646243-32646265 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
971987503 4:33845638-33845660 AAAGATAGAAATTTTAAAGCTGG + Intergenic
971989979 4:33880181-33880203 GTAGATAGAAACTTTAAAGATGG - Intergenic
972038175 4:34553812-34553834 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
972409241 4:38776113-38776135 ACAGATGGAAGTTTCAAAACAGG + Exonic
972847489 4:43006879-43006901 AAAGAGAGAAATTTTAAAGCTGG - Intronic
973040259 4:45460684-45460706 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
973042434 4:45488122-45488144 GCATATAGAGATGTCAAAACTGG + Intergenic
973043018 4:45497714-45497736 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
973533461 4:51856447-51856469 AAAGAAAAAAATTTTAAAACTGG - Intronic
973585930 4:52391027-52391049 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
973693242 4:53462818-53462840 GCAGATAAATATTTTACAATAGG - Intronic
973881966 4:55281692-55281714 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
973943749 4:55936472-55936494 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
974193340 4:58536623-58536645 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
974208799 4:58743045-58743067 AAAGAGAGAAATTTTAAAACTGG + Intergenic
974214692 4:58829605-58829627 AAAGAGAGAAATTTTAAAACTGG + Intergenic
974431923 4:61809570-61809592 GCAGCTAGCAATTTTAAATAGGG - Intronic
974472615 4:62338048-62338070 AAAGAGAGAAATTTTAAAGCCGG + Intergenic
974474679 4:62363138-62363160 GCAATTAGAAATTTTTAAGCAGG - Intergenic
974593878 4:63991753-63991775 GAAGTTAGAAATTTAAAAAAAGG - Intergenic
974639985 4:64616469-64616491 GAAGAAAGAAATTTTAAAAAAGG - Intergenic
974650687 4:64749634-64749656 GCAGAAATGAATTTTAAACCTGG - Intergenic
974710122 4:65580974-65580996 ATGGATAGAAATTTTTAAACTGG - Intronic
974726965 4:65810543-65810565 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
974873165 4:67669070-67669092 GAGGATAGAAATTTTAAAGATGG + Intronic
974986610 4:69034799-69034821 AAAGAGAGAAATTTTAAAGCTGG - Intronic
975091135 4:70405597-70405619 GCAGATTGAAATCTCAGAACTGG - Intronic
975402429 4:73953238-73953260 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
975583130 4:75924630-75924652 GCAAATGGAGATTTTAAAAGGGG + Intronic
975587551 4:75965583-75965605 AAAGAGAGAAATTTTAAAGCTGG - Intronic
975606004 4:76155076-76155098 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
975827050 4:78331011-78331033 AAAGAGAGAAATTTTAAAGCTGG - Intronic
976023690 4:80662299-80662321 AAAGAGAGAAATTTTAAAGCTGG - Intronic
976081837 4:81364339-81364361 TGAGATAGAAATTTTAACAGTGG - Intergenic
976375357 4:84339646-84339668 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
976404333 4:84645156-84645178 ACAGATAGGAATTTTATAGCAGG + Intronic
976437484 4:85034500-85034522 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
976803145 4:89015435-89015457 AAAGAGAGAAATTTTAAAGCTGG - Intronic
976816359 4:89151726-89151748 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
976987550 4:91320977-91320999 TCAGTTTGAAATTTTAAAACAGG + Intronic
977140615 4:93366736-93366758 AAAGAGAGAAATTTTAAAGCCGG - Intronic
977388739 4:96381318-96381340 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
977473559 4:97473785-97473807 AAAGAGAGAAATTTTAAAGCTGG - Intronic
977605748 4:98983820-98983842 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
977690630 4:99905456-99905478 TTAGATAGAAATTTAAAATCTGG + Intronic
978023844 4:103848135-103848157 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
978212030 4:106148382-106148404 AAAGAGAGAAATTTTAAAGCTGG - Intronic
978505569 4:109453004-109453026 AAAGAGAGAAATTTTAAAGCTGG + Intronic
978674765 4:111299212-111299234 GCAGATAGAAAAGAGAAAACAGG + Intergenic
979016502 4:115441347-115441369 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
979137169 4:117124396-117124418 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
979195955 4:117920122-117920144 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
979256100 4:118609482-118609504 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
979332244 4:119431055-119431077 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
979368901 4:119859295-119859317 GCCAATAGAAATAATAAAACTGG + Intergenic
979640536 4:123008581-123008603 TCAGACAGCAATTTTAACACGGG - Intronic
979947479 4:126851235-126851257 AGAAATAGAAATTTTAACACTGG + Intergenic
979970050 4:127123669-127123691 AAAGACAGAAATTTTAAAGCTGG + Intergenic
980123999 4:128755776-128755798 GTAGATAGAAATGTTAAAGCTGG - Intergenic
980232031 4:130057528-130057550 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
980245952 4:130243273-130243295 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
980278252 4:130683909-130683931 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
980313136 4:131161913-131161935 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
980646763 4:135652616-135652638 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
981155747 4:141433024-141433046 GAGGAAAGAAATTTTAAAAATGG - Intergenic
981155953 4:141435343-141435365 GTAAAAAGAAATTTTAAAGCTGG + Intergenic
981421089 4:144551181-144551203 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
981448409 4:144867259-144867281 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
981739700 4:147989075-147989097 AAAGAGAGAAATTTTAAAGCTGG + Intronic
982156460 4:152527001-152527023 GTAGATAGAAGATTTAAATCAGG - Intronic
982175331 4:152700789-152700811 AAAGAGAGAAATTTTAAAGCTGG + Intronic
982542115 4:156686622-156686644 GCAGATTGACATAGTAAAACAGG + Intergenic
982558287 4:156897422-156897444 GCAGAATGAAAATTTAAAAATGG - Intronic
982758780 4:159255269-159255291 GAAGAAAGAAGTTTTAAAAATGG - Intronic
982807920 4:159789454-159789476 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
982830654 4:160055542-160055564 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
983224122 4:165070207-165070229 TCAGATAGAAATTTCAAATTGGG - Intergenic
983304316 4:165966607-165966629 AAAGAGAGAAATTTTAAAGCTGG + Intronic
983419165 4:167495962-167495984 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
983815796 4:172125313-172125335 ACAAATAGAAACTGTAAAACAGG + Intronic
983894123 4:173063520-173063542 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
984018607 4:174456482-174456504 CCAGAAAGAACTTTTAAAAATGG - Intergenic
984064209 4:175028189-175028211 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
984324580 4:178235940-178235962 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
984611585 4:181845629-181845651 GCAGGCAGAAATTTTATAACTGG - Intergenic
984655634 4:182314894-182314916 GGAAACAGAAATTTTAAAAATGG - Intronic
984813030 4:183811506-183811528 GGAGATGGAAGATTTAAAACAGG - Intergenic
984905911 4:184625694-184625716 CAAGAGAGAAATTTTAAAGCTGG + Intergenic
985299262 4:188470577-188470599 TCAGACAAAAATTATAAAACTGG + Intergenic
985469285 5:28260-28282 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
985729172 5:1537569-1537591 GTAGATAGAAATTTAAAAAACGG + Intergenic
986103816 5:4640815-4640837 ACAGACAGAAATTATAAAAGAGG + Intergenic
986305763 5:6514752-6514774 TTAGATAGAAACTGTAAAACAGG + Intergenic
987214344 5:15717445-15717467 GCAGACAGACAATTTCAAACAGG - Intronic
987571884 5:19675016-19675038 AAAGAGAGAAATTTTAAAACTGG + Intronic
987583225 5:19822515-19822537 AAAGAGAGAAATTTTAAAGCTGG + Intronic
987873631 5:23651081-23651103 TCAAATAGAAGTTTTAAACCTGG + Intergenic
988047019 5:25969526-25969548 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
988168275 5:27622589-27622611 GAAGATAGATATTTAAAAAGAGG - Intergenic
988222583 5:28368420-28368442 AAAGAGAGAAATTTTAAAGCCGG + Intergenic
988240335 5:28599903-28599925 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
988245461 5:28675057-28675079 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
988343478 5:30006158-30006180 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
988697544 5:33638325-33638347 GCTGTTAGTGATTTTAAAACAGG - Intronic
988853731 5:35205168-35205190 TAAGATAAAAATCTTAAAACCGG + Intronic
989307184 5:39972096-39972118 GCTGATAGAAAATATAAAGCAGG - Intergenic
989373686 5:40736814-40736836 GCAGATAGAAATGATAAAGTTGG + Intronic
989455111 5:41634968-41634990 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
989580249 5:43025762-43025784 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
989771582 5:45152466-45152488 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
989828615 5:45889271-45889293 AAAGATAGAAATTTTAAAGCTGG + Intergenic
990093121 5:52080522-52080544 GGAGATAGGAATTCTAAAATTGG + Intronic
990123784 5:52488610-52488632 AAAGAGAGAAATTTTAAAGCGGG - Intergenic
990234470 5:53752074-53752096 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
990300527 5:54445220-54445242 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
990302325 5:54461260-54461282 AAAGACAGAAATTTTAAAGCTGG + Intergenic
990339578 5:54809085-54809107 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
990395545 5:55374928-55374950 AAAGAGAGAAATTTTAAAGCCGG + Intronic
990825169 5:59891921-59891943 GCAGTTATAAATTGTAAATCAGG - Intronic
991181895 5:63761764-63761786 GCAAATGCATATTTTAAAACGGG + Intergenic
991233652 5:64366952-64366974 AAAGATAGAATTTTTAGAACAGG + Intronic
991250828 5:64559224-64559246 AAAGAGAGAAATTTTAAAGCTGG - Intronic
991626075 5:68602224-68602246 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
991712608 5:69422816-69422838 AAAGAGAGAAATTTTAAAGCTGG - Intronic
991991566 5:72344716-72344738 AAAGAGAGAAATTTTAAAGCTGG + Intronic
992160235 5:73993851-73993873 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
992210356 5:74473435-74473457 GCATAAATAATTTTTAAAACTGG - Intergenic
992922000 5:81534638-81534660 GGCAATAGAAATTTCAAAACAGG + Intronic
993067722 5:83120814-83120836 GCATATAGAAAGTATACAACTGG + Intronic
993161021 5:84291042-84291064 ACATATTGAAATTTTAAAGCAGG - Intronic
993198230 5:84778322-84778344 GAAGATAGAAATTTCAAATTAGG - Intergenic
993434937 5:87881312-87881334 GAAGATAAAAATTTGAAAAAAGG + Intergenic
993950473 5:94169279-94169301 GAAGTTAAAAAATTTAAAACTGG + Intronic
994324195 5:98430062-98430084 GGAGAGAGAAATTTAAAAAAAGG - Intergenic
994734389 5:103534119-103534141 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
994744645 5:103663657-103663679 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
995019021 5:107346374-107346396 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
995120056 5:108526470-108526492 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
995225374 5:109694509-109694531 CAAAATAAAAATTTTAAAACTGG - Intronic
995370902 5:111418152-111418174 AAAGAGAGAAATTTTAAAGCTGG + Intronic
995593910 5:113728816-113728838 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
995671225 5:114605421-114605443 CAAGATAGAAATTTTAAGATAGG - Intergenic
996100126 5:119437178-119437200 AAAGAGAGAAATTTTAAACCTGG - Intergenic
996104224 5:119480373-119480395 AAAGAGAGAAATTTTAAAGCTGG + Intronic
996268727 5:121576927-121576949 CCACATGGAAATTTTAAAAAAGG - Intergenic
996296955 5:121930707-121930729 CCATATAGTATTTTTAAAACTGG + Intergenic
996753361 5:126911379-126911401 AAAGAGAGAAATTTTAAAGCTGG - Intronic
996893220 5:128447801-128447823 AAAGAGAGAAATTTTAAAGCTGG - Intronic
997089808 5:130843508-130843530 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
997765432 5:136498878-136498900 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
997806045 5:136918996-136919018 CCATAAAGAAATTTTAAGACTGG - Intergenic
997920825 5:137977510-137977532 AAAGAGAGAAATTTTAAAGCTGG - Intronic
998585126 5:143419515-143419537 AAAGAGAGAAATTTTAAAGCTGG + Intronic
998605546 5:143630806-143630828 GCATATAGAAAGGTCAAAACTGG - Intergenic
998642004 5:144021782-144021804 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
998777177 5:145616506-145616528 AAAGAGAGAAATTTTAAAGCTGG + Intronic
999093179 5:148955416-148955438 AAAGAGAGAAATTTTAAAGCTGG + Intronic
999308736 5:150537838-150537860 GAAGAGAGAAATTTTAAAGCTGG - Intronic
1000004496 5:157170506-157170528 AAAGAGAGAAATTTTAAAGCTGG - Intronic
1000471729 5:161651717-161651739 AAAGAGAGAAATTTTAAAGCTGG + Intronic
1000562703 5:162810367-162810389 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1000615315 5:163419478-163419500 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1001047115 5:168382665-168382687 GGAGATGGAATTTGTAAAACTGG - Intronic
1001189814 5:169619218-169619240 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1001521565 5:172397557-172397579 AAAGAGAGAAATTTTAAAGCTGG - Intronic
1001522148 5:172402562-172402584 GAAGAGAGAAATTTTAAAGCTGG - Intronic
1002495157 5:179606714-179606736 GAGGATAGAAATCATAAAACAGG + Intronic
1002651637 5:180700895-180700917 AAAGAAAGAAATTTTAAAGCTGG - Intergenic
1002726905 5:181305000-181305022 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1002913303 6:1507678-1507700 GGAAATAGAATTTTTAAAATTGG + Intergenic
1003068872 6:2928452-2928474 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1003079389 6:3008742-3008764 AAAGAGAGAAATTTTAAAGCTGG + Intronic
1003801981 6:9680583-9680605 AAAGAGAGAAATTTTAAAGCTGG + Intronic
1003855742 6:10272676-10272698 GCAGATAGAACCTTGAATACTGG + Intergenic
1003948610 6:11097350-11097372 GCAGATAAAGATTTTTAAAGAGG - Intronic
1004164491 6:13244101-13244123 AAAGAGAGAAATTTTAAAGCTGG + Intronic
1004418768 6:15448992-15449014 ACAGATGGAAAATTTAAAAGGGG + Intronic
1004471258 6:15931495-15931517 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1004778297 6:18873641-18873663 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1005132425 6:22524448-22524470 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1005663896 6:28029554-28029576 GCAGAAGGAAAGTTTGAAACTGG + Intergenic
1005693266 6:28327944-28327966 AAAGAGAGAAATTTTAAAGCTGG + Intronic
1005971393 6:30764632-30764654 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1005985310 6:30869776-30869798 AAAGAGAGAAATTTTACAACTGG - Intergenic
1006198500 6:32263916-32263938 GCAAATGGAAATTTTATAGCTGG - Intergenic
1006218321 6:32465570-32465592 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1006238342 6:32655836-32655858 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1006265482 6:32918660-32918682 AAAGATTGAAATTTAAAAACAGG + Intergenic
1006269662 6:32954060-32954082 GATGATAGAGATATTAAAACTGG + Intronic
1006418011 6:33916367-33916389 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1006661821 6:35652899-35652921 AAAGAGAGAAATTTTAAAGCTGG - Intronic
1006978736 6:38128327-38128349 GGAAATAAAAATTTTAAAAGAGG - Intronic
1007302082 6:40875159-40875181 ACAGAGAGAAATTATAAAATAGG - Intergenic
1007437414 6:41825125-41825147 GGAGGTTGATATTTTAAAACAGG - Intronic
1007861799 6:44917906-44917928 ACCGATAGAAATTTTAAAGTAGG - Intronic
1008100533 6:47385670-47385692 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1008251198 6:49242214-49242236 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1008585523 6:52944865-52944887 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1008836405 6:55836888-55836910 GGATATAAAAATTTTAAATCAGG + Intronic
1008862343 6:56164317-56164339 TCAGATAGAAATTTCTCAACAGG + Intronic
1008909651 6:56719728-56719750 AAAGAGAGAAATTTTAAAGCTGG + Intronic
1008983862 6:57518977-57518999 AAAGAGAGAAATTTTAAAGCTGG + Intronic
1009039119 6:58156296-58156318 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1009044226 6:58218203-58218225 GCAGATAGAAATGCTAATATTGG - Intergenic
1009171919 6:60411884-60411906 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1009215012 6:60911137-60911159 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1009544207 6:65003659-65003681 AAAGAGAGAAATTTTAAAGCTGG - Intronic
1009767217 6:68094927-68094949 TCAAATAGAAATTTTATACCTGG + Intergenic
1009886459 6:69629301-69629323 CCAAATAGAAATTTTAGAAATGG + Intergenic
1009896176 6:69753254-69753276 GAATATACAGATTTTAAAACAGG - Intronic
1010102934 6:72131417-72131439 AAAGAGAGAAATTTTAAAGCTGG + Intronic
1010189354 6:73179110-73179132 GAAGATAGAATTTTCCAAACTGG + Intronic
1010236167 6:73576539-73576561 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1010305015 6:74309922-74309944 AAAGAAAGAAATTTTAAAGCTGG + Intergenic
1010489738 6:76461210-76461232 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1010859061 6:80882362-80882384 GCAAATAAAAAATGTAAAACAGG + Intergenic
1010881771 6:81184051-81184073 CAAGATAGAAATATTAACACTGG + Intergenic
1011001349 6:82591559-82591581 GCAGGTAGAGTGTTTAAAACTGG - Intergenic
1011066137 6:83327869-83327891 GAAGAGAGAAATTTTAAAGCTGG - Intronic
1011474668 6:87739658-87739680 TCAGTTAAAAATTTTAGAACAGG + Intergenic
1011586575 6:88932560-88932582 AAAGAGAGAAATTTTAAAGCTGG - Intronic
1012050208 6:94332247-94332269 GCAGAAAGAAATTCAAAACCTGG + Intergenic
1012143465 6:95651791-95651813 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1012216453 6:96591817-96591839 AAAGAGAGAAATTTTAAAGCTGG + Intronic
1012380703 6:98616190-98616212 AAAGAGAGAAATTTTAAACCTGG + Intergenic
1013346873 6:109269086-109269108 GAAGAGATAAATTTTAAAGCTGG - Intergenic
1013664065 6:112328647-112328669 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1013865179 6:114688395-114688417 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1013927701 6:115493201-115493223 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1014058721 6:117046340-117046362 GCATATAGCATTTTTAAGACTGG - Intergenic
1014119853 6:117712339-117712361 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1014251457 6:119119422-119119444 AAAGAGAGAAATTTTAAAGCTGG - Intronic
1014257549 6:119177815-119177837 GCAGATAGAATATTAAAATCAGG - Exonic
1014290713 6:119554499-119554521 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1014319370 6:119907530-119907552 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1014403335 6:121017638-121017660 GCAGAAAGAAATAGAAAAACAGG - Intergenic
1014425320 6:121297339-121297361 TAAGACAGAAATTTTAAAAAAGG + Intronic
1014469560 6:121798168-121798190 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1015090748 6:129354967-129354989 GCAAATAAGAATTATAAAACTGG - Intronic
1015180787 6:130360383-130360405 AAAGAGAGAAATTTTAAAGCTGG + Intronic
1015323386 6:131901078-131901100 ATAGAAAGAGATTTTAAAACAGG - Intergenic
1015545384 6:134356306-134356328 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1016023998 6:139266291-139266313 GCAGACAAGTATTTTAAAACAGG + Intronic
1016112269 6:140240169-140240191 TAAGATAGAAATTATAAAACTGG - Intergenic
1016192933 6:141293537-141293559 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1016440909 6:144082437-144082459 GCAGATAGGAATTTTTAAGATGG - Intergenic
1016493548 6:144633973-144633995 GCAGCTAGACATTTAAAAGCAGG - Intronic
1016554499 6:145320788-145320810 GCAGATAAAACCTTTCAAACTGG + Intergenic
1016586755 6:145697181-145697203 AAAGAGAGAAATTTTAAAGCTGG + Intronic
1016865747 6:148764586-148764608 AAAGAGAGAAATTTTAAAGCTGG + Intronic
1017355994 6:153509561-153509583 GCAAATATAAATTTAAAAAGAGG + Intergenic
1017854579 6:158339148-158339170 AAAGAGAGAAATTTTAAAGCTGG + Intronic
1018059794 6:160081262-160081284 AAAGAGAGAAATTTTAAAGCTGG + Intronic
1018985224 6:168631188-168631210 AAAGAGAGAAATTTTAAAGCTGG - Intronic
1019878048 7:3833121-3833143 GAAGATACAAATGTCAAAACTGG + Intronic
1020048426 7:5062312-5062334 GAAGAGAGAAATTTTAAAGCTGG + Intronic
1020329086 7:7000008-7000030 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1020603634 7:10307461-10307483 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1020615697 7:10458176-10458198 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1020637097 7:10710127-10710149 ACAGACAGAAATTTTAAATTTGG + Intergenic
1020738432 7:11983192-11983214 AAAGACAGAAATTTTAAAGCTGG + Intergenic
1020778412 7:12486702-12486724 GCAAATACAAATTTGAATACAGG - Intergenic
1020834916 7:13136877-13136899 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1020880990 7:13763318-13763340 TCAGATAGAAATGAGAAAACGGG + Intergenic
1020881853 7:13771811-13771833 GGACATAGAAAGTTTAAAAAAGG - Intergenic
1020909287 7:14108619-14108641 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1020915066 7:14183355-14183377 GAAGACATAAATTTTAAAAGGGG + Intronic
1020981418 7:15074060-15074082 GATGGTAGGAATTTTAAAACTGG + Intergenic
1021730920 7:23594996-23595018 ACAGATACAAAGTTTAAAAAAGG - Intergenic
1022148172 7:27569173-27569195 CCAAATGGAAATTTTATAACTGG - Intronic
1022201519 7:28122128-28122150 TCAGATAGAAGATTTAAAATTGG - Intronic
1022240764 7:28510524-28510546 GCAGCTAGAAGTTTTAAAGGTGG - Intronic
1022757984 7:33314904-33314926 GGAGAGAGAATTTTTAAAAGAGG + Intronic
1023491651 7:40749167-40749189 GCAAATAAAAATTTTAAGAGTGG + Intronic
1023565879 7:41523272-41523294 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1023668905 7:42555503-42555525 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1024010635 7:45263293-45263315 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1024018960 7:45348051-45348073 CCAGACAGAATTTTTAAACCTGG - Intergenic
1024071805 7:45792613-45792635 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1024122850 7:46262212-46262234 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1024213129 7:47224002-47224024 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1024370109 7:48573168-48573190 TCAAATAAAAATTTTATAACTGG - Intronic
1024402977 7:48946382-48946404 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1024408777 7:49014707-49014729 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1024497380 7:50064112-50064134 AAAGAGAGAAATTTTAAAGCTGG + Intronic
1024586473 7:50846087-50846109 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1024756630 7:52541176-52541198 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1024871911 7:53973389-53973411 GCAGAAAGAAATTATAAAAGAGG - Intergenic
1024922623 7:54575412-54575434 GCAGTTAGAATTTTAAAAAGAGG + Intergenic
1024942418 7:54776448-54776470 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1024946186 7:54809463-54809485 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1025062594 7:55823499-55823521 TCAGATAGAAGCTTTAACACAGG + Intronic
1025108876 7:56196093-56196115 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1025116800 7:56265109-56265131 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1025749443 7:64280677-64280699 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1025760121 7:64381807-64381829 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1027378209 7:77575575-77575597 AGAAATAGAATTTTTAAAACAGG + Intronic
1027793188 7:82658555-82658577 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1027986509 7:85298358-85298380 GCAGAAAAAATATTTAAAACAGG - Intergenic
1028435081 7:90794042-90794064 AAAGAGAGAAATTTTAAAGCTGG + Intronic
1028539332 7:91925085-91925107 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1028786993 7:94806985-94807007 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1028999847 7:97141455-97141477 AAAGAGAGAAATTTTAAAGCTGG - Intronic
1029003176 7:97177861-97177883 GCAGAGATAGATTTTAAAGCAGG - Intronic
1029067135 7:97861409-97861431 GGAGAAAGAAGTTTGAAAACTGG - Intronic
1029415235 7:100438550-100438572 ACAAATATAAATTTTTAAACTGG + Intergenic
1029685496 7:102144737-102144759 GCAACTAGAAATTTCAAAACTGG - Intronic
1030056081 7:105584692-105584714 GGAGAGAGAAATTTTAAAGCTGG - Intronic
1030070927 7:105696887-105696909 AAAGAGAGAAATTTTAAAGCTGG + Intronic
1030423327 7:109338131-109338153 AGATAAAGAAATTTTAAAACTGG + Intergenic
1030601470 7:111597607-111597629 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1030615177 7:111731273-111731295 GCTGATAGAAATTGAGAAACGGG - Intronic
1030663712 7:112250565-112250587 AAAGAGAGAAATTTTAAAGCCGG - Intronic
1030731024 7:112989176-112989198 ACATACAGAAATTTTAAAAAAGG + Intergenic
1030854940 7:114543905-114543927 GAGGATAAAAATTTTAAGACAGG - Intronic
1031148580 7:118026086-118026108 GAAGATGGAAATTTTCAAAATGG + Intergenic
1031172230 7:118306980-118307002 GAAGAGAGAAATTTGAACACAGG - Intergenic
1031229282 7:119084721-119084743 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1031275738 7:119720862-119720884 CCTGAAAGAAATTTTAAAAGTGG + Intergenic
1031305560 7:120121979-120122001 GCAGAAACAAATTTTATATCAGG + Intergenic
1031388688 7:121186051-121186073 GCATAAAGACATTTTAAAAATGG + Intronic
1031510408 7:122641966-122641988 AAAGATAGAAATATTAAAAATGG + Intronic
1031513950 7:122679711-122679733 AAAGAGAGAAATTTTAAAGCTGG - Intronic
1031560124 7:123228208-123228230 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1031626123 7:123995230-123995252 TCATATAATAATTTTAAAACAGG - Intergenic
1031636193 7:124103838-124103860 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1031838289 7:126705066-126705088 AAAGAGAGAAATTTTAAAGCTGG - Intronic
1031930421 7:127680042-127680064 AAAGAGAGAAATTTTAAAGCTGG + Intronic
1031952710 7:127908856-127908878 GCAGATACAGAGTGTAAAACAGG + Intronic
1032048419 7:128630218-128630240 AAAGAGAGAAATTTTAAAACTGG + Intergenic
1032937055 7:136745240-136745262 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1033677039 7:143553018-143553040 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1033694796 7:143776419-143776441 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1033721272 7:144061647-144061669 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1033949486 7:146766097-146766119 CCAGATGGATTTTTTAAAACTGG - Intronic
1034363417 7:150522811-150522833 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1034583800 7:152070860-152070882 AAAGAGAGAAATTTTAAAGCTGG + Intronic
1034929687 7:155151901-155151923 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1035572795 8:684727-684749 AAAGAGAGAAATTTTAAAGCTGG + Intronic
1035592581 8:827899-827921 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1035686838 8:1529805-1529827 AAAGAGAGAAATTTTAAAGCTGG + Intronic
1036158398 8:6363731-6363753 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1036373755 8:8182700-8182722 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1036495909 8:9269782-9269804 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1036877148 8:12482941-12482963 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1036999240 8:13698157-13698179 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1037057349 8:14458501-14458523 GAGGAAAGAAATTTTAAAAAGGG + Intronic
1037870311 8:22488348-22488370 GCATATACACATTTTGAAACAGG - Intronic
1037959796 8:23087958-23087980 CCAAATGGAAATTTTAAAACTGG + Intronic
1038204905 8:25457669-25457691 GCAGACAGGATTTTTAAAATGGG - Intronic
1038786515 8:30622269-30622291 AAAGAGAGAAATTTTAAAGCTGG + Intronic
1038843311 8:31205982-31206004 CTAAATAAAAATTTTAAAACTGG - Intergenic
1038991940 8:32877717-32877739 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1038993493 8:32895442-32895464 GCAAATAGAAAATTTATAAAAGG + Intergenic
1039318169 8:36396119-36396141 GAAGATTGAAATTTTCAGACTGG - Intergenic
1040139441 8:43893512-43893534 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1040353309 8:46589928-46589950 CAAGAAAGAAATTTTACAACTGG - Intergenic
1040538804 8:48333041-48333063 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1040634370 8:49254955-49254977 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1040679023 8:49786863-49786885 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1040826172 8:51623072-51623094 GAAAATTGAAATTTTAAACCAGG - Intronic
1041033910 8:53767082-53767104 AAAGAGAGAAATTTTAAAGCTGG - Intronic
1041524240 8:58787937-58787959 GCATATAGTAATTTCAAAAGGGG + Intergenic
1041559645 8:59201587-59201609 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1041584106 8:59495969-59495991 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1041649698 8:60289801-60289823 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1041746640 8:61214389-61214411 AAAGAGAGAAATTTTAAAGCTGG - Intronic
1041990970 8:63991286-63991308 GGAGCAAGATATTTTAAAACAGG + Intergenic
1042010370 8:64238280-64238302 GCAAAAAGAAATGTTAAAAATGG + Intergenic
1042190322 8:66179060-66179082 GCAGATAGACGTTTAAAAGCTGG - Intergenic
1042355564 8:67823986-67824008 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1042709200 8:71696681-71696703 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1043324469 8:79033556-79033578 AAAGAGAGAAATTTTAAAACTGG - Intergenic
1043327516 8:79070648-79070670 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1043584106 8:81747682-81747704 AAAGAGAGAAATTTTAAAACTGG + Intronic
1043619565 8:82172447-82172469 GCAGAAAAAAAATTTAAAACAGG + Intergenic
1043945049 8:86240237-86240259 GCAGACAAACATTTTAAATCAGG + Intronic
1044003412 8:86913494-86913516 AAAGAGAGAAATTTTAAAGCTGG + Intronic
1044086231 8:87945413-87945435 AAAGAAAGAAATTTTAAAGCTGG + Intergenic
1044142237 8:88670547-88670569 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1044170405 8:89043962-89043984 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1044590300 8:93907912-93907934 AAAGAGAGAAATTTTAAAGCTGG + Intronic
1044754700 8:95448956-95448978 GTAGAGAGAACTTTTAAAAGTGG - Intergenic
1045023998 8:98069107-98069129 GCATATAGAAATTATATAAATGG + Intronic
1045095872 8:98797905-98797927 AGAGAAAGAAATTTTAAAAGAGG + Intronic
1045110742 8:98937810-98937832 GCAGATACAAGTTTTAACAAAGG - Intronic
1045316451 8:101047726-101047748 GTATACAGAAATTTCAAAACTGG - Intergenic
1045633387 8:104154554-104154576 AGAAATAGAAATTTTAAAATAGG + Intronic
1045954311 8:107889201-107889223 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1046076617 8:109319883-109319905 AAAGAGAGAAATTTTAAAGCCGG + Intronic
1046153314 8:110256529-110256551 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1046187904 8:110746853-110746875 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1047633507 8:126733996-126734018 GCAGAAATAAATTTTAAAAAGGG - Intergenic
1047668621 8:127120233-127120255 GCACATAGAAATAATAAAATGGG + Intergenic
1048002964 8:130394704-130394726 AAAGAGAGAAATTTTAAAGCTGG - Intronic
1048479099 8:134771222-134771244 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1048809636 8:138274258-138274280 AAAGAGAGAAATTTTAAAGCTGG + Intronic
1048820298 8:138374154-138374176 AAAGAGAGAAATTTTAAAGCTGG - Intronic
1048825670 8:138423428-138423450 AAAGAGAGAAATTTTAAAGCTGG + Intronic
1049500795 8:142964172-142964194 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1049839296 8:144760718-144760740 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1050375013 9:4962057-4962079 GCCGATAGAAATTTTCAAAATGG - Intergenic
1050401432 9:5259843-5259865 AAAGAGAGAAATTTTAAACCTGG - Intergenic
1051081656 9:13301098-13301120 GCATATAGAATTTTTCAACCAGG - Intergenic
1051549860 9:18316001-18316023 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1051742632 9:20266293-20266315 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1051833844 9:21311801-21311823 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1052083759 9:24238950-24238972 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1052166015 9:25328696-25328718 GCAGACCGCAATTTTAAAACAGG + Intergenic
1052354933 9:27494449-27494471 AAAGAGAGAAATTTTAAAGCTGG - Intronic
1052390613 9:27875045-27875067 GCATATAGATATTTAAGAACAGG + Intergenic
1052426415 9:28311082-28311104 AAAGAGAGAAATTTTAAAGCTGG + Intronic
1053651553 9:40175072-40175094 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1053703621 9:40727352-40727374 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1054413681 9:64850816-64850838 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1054533029 9:66201130-66201152 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1054978059 9:71171441-71171463 AAAGAGAGAAATTTTAAAGCCGG - Intronic
1055340139 9:75272839-75272861 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1055440989 9:76335959-76335981 GAAGATAGAATTTTTAATCCTGG - Intronic
1055585171 9:77751549-77751571 GCGGACAGAAATTTTATAATGGG + Intronic
1055652164 9:78417131-78417153 GCAGATTGAATTTTGAAAGCAGG - Intergenic
1055784908 9:79862205-79862227 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1055830401 9:80371793-80371815 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1055907997 9:81316053-81316075 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1055941710 9:81656434-81656456 GCATATATCATTTTTAAAACTGG - Intronic
1056082897 9:83115053-83115075 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1056470290 9:86899230-86899252 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1056894896 9:90536065-90536087 GAAGAGAGAAATTTTAAAGCTGG + Intergenic
1057013370 9:91628356-91628378 AAAGAGAGAAATTTTAAAGCTGG - Intronic
1057099203 9:92341470-92341492 AAAGAGAGAAATTTTAAAGCTGG - Intronic
1057122281 9:92587162-92587184 GGAGACAGAAATTATAAAAAGGG + Intronic
1057145364 9:92755539-92755561 AAAGAGAGAAATTTTAAAGCTGG - Intronic
1057453758 9:95189202-95189224 GGACATATAAATTTTAAAAAGGG - Intronic
1057458757 9:95239382-95239404 GAGGCTAGAAATTTTTAAACAGG + Intronic
1057538761 9:95944732-95944754 AAAGAGAGAAATTTTAAAGCTGG + Intronic
1057715651 9:97493305-97493327 AAAGAGAGAAATTTTAAAGCTGG + Intronic
1058253211 9:102728773-102728795 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1058265245 9:102890641-102890663 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1058268483 9:102937591-102937613 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1058288751 9:103211320-103211342 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1058549099 9:106094039-106094061 AAAGAGAGAAATTTTAAAACTGG - Intergenic
1058922675 9:109632178-109632200 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1059022344 9:110590225-110590247 AAAGACAGAAATTTTAAAGCTGG - Intergenic
1059281889 9:113141507-113141529 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1060436889 9:123601040-123601062 GCATTTAGCAATGTTAAAACTGG - Intronic
1061104614 9:128519861-128519883 AAAGAGAGAAATTTTAAAGCTGG - Intronic
1061429444 9:130521988-130522010 GCACATAAAGATCTTAAAACAGG + Intergenic
1061530963 9:131212489-131212511 AAAGAGAGAAATTTTAAAGCTGG - Intronic
1062752026 9:138262476-138262498 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1186132124 X:6479073-6479095 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1186149930 X:6664209-6664231 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1186329200 X:8514189-8514211 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1186576349 X:10770278-10770300 GAAGAAAGAAAATTAAAAACAGG - Intronic
1186598242 X:11007595-11007617 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1186803578 X:13117393-13117415 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1186875666 X:13815169-13815191 TCAGAGAGAAATTTAAAAAAGGG + Intronic
1186994483 X:15105574-15105596 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1187122508 X:16423066-16423088 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1187433773 X:19248463-19248485 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1188255826 X:27960986-27961008 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1188256240 X:27965176-27965198 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1188461979 X:30438349-30438371 GCTGAAAGAAATTTTAAGACAGG + Intergenic
1188571645 X:31593158-31593180 GCATATAGAAAATCTAAAAGTGG + Intronic
1188683885 X:33045545-33045567 GCAGGTAAAAACTTTTAAACAGG - Intronic
1188753047 X:33926797-33926819 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1188776479 X:34226295-34226317 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1188822879 X:34796964-34796986 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1188823614 X:34803330-34803352 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1188849573 X:35115064-35115086 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1188979371 X:36713366-36713388 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1189509567 X:41648583-41648605 AAAGAGAGAAATTTTAAAGCTGG - Intronic
1189557551 X:42161436-42161458 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1189621401 X:42844003-42844025 TCAGATTAAAAGTTTAAAACGGG - Intergenic
1189978928 X:46489776-46489798 AAAGAGAGAAATTTTAAAGCTGG + Intronic
1190002058 X:46698332-46698354 AAAGAGAGAAATTTTAAAGCTGG - Intronic
1190061895 X:47217078-47217100 GCAGGTAGGAATTTTTAAATCGG + Intergenic
1190152739 X:47961837-47961859 AAAGAGAGAAATTTTAAAGCTGG + Intronic
1190166661 X:48078705-48078727 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1190185954 X:48234423-48234445 AAAGAGAGAAATTTTAAAGCTGG - Intronic
1190366220 X:49696904-49696926 GCAAATGGAAATTTTAGAAGTGG + Intergenic
1190552535 X:51599590-51599612 ACAGATAGGATTTTAAAAACAGG + Intergenic
1190616351 X:52236887-52236909 GAAGAGAGAAATTTTAAAGCTGG - Intergenic
1190651418 X:52572235-52572257 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1190882875 X:54505545-54505567 ACACATAGAAATTTAGAAACAGG - Intergenic
1191008404 X:55736307-55736329 TCAGATAAAAATTTTAAAAAAGG - Intronic
1191148446 X:57193613-57193635 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1191161111 X:57330701-57330723 AAAGAAAGAAATTTTAAAGCTGG - Intronic
1191244827 X:58218975-58218997 AAAGAGAGAAATTTTAAAGCAGG + Intergenic
1191596105 X:62945858-62945880 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1191654476 X:63581251-63581273 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1191721946 X:64238532-64238554 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1191803062 X:65102780-65102802 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1191814735 X:65231089-65231111 AAAGAGAGAAATTTTACAACTGG + Intergenic
1192059679 X:67811465-67811487 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1192077686 X:68017008-68017030 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1192752169 X:74004840-74004862 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1192753878 X:74024973-74024995 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1193025782 X:76844347-76844369 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1193301764 X:79897270-79897292 AAAGAGAGAAATTTTAAACCTGG - Intergenic
1193594796 X:83432945-83432967 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1193994193 X:88344692-88344714 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1194052276 X:89084755-89084777 GTTCATATAAATTTTAAAACTGG - Intergenic
1194102030 X:89717588-89717610 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1194194997 X:90881878-90881900 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1194800825 X:98270062-98270084 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1194923315 X:99794305-99794327 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1195038316 X:100990451-100990473 TCAAATGGAAATTTAAAAACCGG - Intronic
1195234853 X:102887300-102887322 GCAGATAAAAAATTAAAACCTGG - Intergenic
1195734348 X:107997445-107997467 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1195823166 X:108969420-108969442 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1195838373 X:109144621-109144643 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1195845564 X:109223989-109224011 CCAAATGGAAATTTGAAAACTGG + Intergenic
1196238054 X:113306127-113306149 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1196534921 X:116832536-116832558 GCAAATTGAAATTCTAACACAGG + Intergenic
1196713407 X:118787226-118787248 AAAGAGAGAAATTTTAAAGCTGG + Intronic
1196857502 X:119998253-119998275 GAGGATAGACATTTTCAAACCGG - Intergenic
1197071713 X:122306623-122306645 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1197113265 X:122801031-122801053 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1197127634 X:122966194-122966216 ACAAATTTAAATTTTAAAACTGG - Intergenic
1197462274 X:126757162-126757184 GCAGTCTGAAATTTTAAAAATGG - Intergenic
1197473934 X:126896839-126896861 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1197630707 X:128854260-128854282 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1197938579 X:131765139-131765161 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1198072634 X:133164649-133164671 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1198864267 X:141104805-141104827 CCAGATATAATTTTTAAAGCAGG - Intergenic
1198898422 X:141482611-141482633 CCAGATATAATTTTTAAAGCAGG + Intergenic
1198912496 X:141629960-141629982 AAAGAGAGAAATTTTAAAGCTGG - Intronic
1198994765 X:142561548-142561570 AAAGAAAGAAATTTTAAAGCTGG - Intergenic
1199289295 X:146088684-146088706 CCATATAGAAATTTCAAAATTGG + Intergenic
1199337767 X:146640485-146640507 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1199360732 X:146915505-146915527 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1199476957 X:148256628-148256650 AAAGAGAGAAATTTTAAAGCCGG + Intergenic
1199604367 X:149564928-149564950 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1199884249 X:152003277-152003299 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1199888597 X:152050174-152050196 ACAGATATTAATTTTAATACTGG - Intergenic
1199943367 X:152646554-152646576 TCAGATAAAATTTTAAAAACAGG + Intronic
1200356369 X:155556420-155556442 AAAGAGAGAAATTTTAAAGCTGG + Intronic
1200502032 Y:3962485-3962507 TGAGAAAGAAAATTTAAAACTGG - Intergenic
1200541618 Y:4464288-4464310 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1200950508 Y:8894198-8894220 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1201342967 Y:12953850-12953872 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1201427908 Y:13874541-13874563 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1201478434 Y:14410398-14410420 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1201778064 Y:17688064-17688086 GAAGAGAGAAATTTTAAAGATGG - Intergenic
1201823493 Y:18217928-18217950 GAAGAGAGAAATTTTAAAGATGG + Intergenic
1201913042 Y:19152986-19153008 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1202132673 Y:21628122-21628144 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1202247399 Y:22833935-22833957 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1202328824 Y:23722929-23722951 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1202340411 Y:23858627-23858649 AAAGAGAGAAATTTTAAAGCAGG - Intergenic
1202346252 Y:23931259-23931281 AAAGAGAGAAATTTTAAACCTGG + Intergenic
1202400387 Y:24467683-24467705 AAAGAGAGAAATTTTAAAGCTGG + Intergenic
1202470393 Y:25202403-25202425 AAAGAGAGAAATTTTAAAGCTGG - Intergenic
1202524519 Y:25738831-25738853 AAAGAGAGAAATTTTAAACCTGG - Intergenic
1202530355 Y:25811455-25811477 AAAGAGAGAAATTTTAAAGCAGG + Intergenic
1202541947 Y:25947125-25947147 AAAGAGAGAAATTTTAAAGCTGG + Intergenic