ID: 1074336596

View in Genome Browser
Species Human (GRCh38)
Location 10:112582502-112582524
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074336595_1074336596 0 Left 1074336595 10:112582479-112582501 CCATCTCTGGTCATCTTGCTTGT 0: 1
1: 0
2: 0
3: 14
4: 267
Right 1074336596 10:112582502-112582524 GAGCCCTTCTCCAGATCTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr