ID: 1074338866

View in Genome Browser
Species Human (GRCh38)
Location 10:112606318-112606340
Sequence CAGAATAGCACGCAATGGCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074338866_1074338870 30 Left 1074338866 10:112606318-112606340 CCCGGCCATTGCGTGCTATTCTG No data
Right 1074338870 10:112606371-112606393 CTTCATGCCCTCACCACCCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074338866 Original CRISPR CAGAATAGCACGCAATGGCC GGG (reversed) Intronic
No off target data available for this crispr