ID: 1074340415

View in Genome Browser
Species Human (GRCh38)
Location 10:112623350-112623372
Sequence TAGAGTAGCCCCAAAAAGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074340412_1074340415 -6 Left 1074340412 10:112623333-112623355 CCATGTTCCCATTTTATTAGAGT 0: 1
1: 0
2: 0
3: 11
4: 231
Right 1074340415 10:112623350-112623372 TAGAGTAGCCCCAAAAAGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074340415 Original CRISPR TAGAGTAGCCCCAAAAAGTC AGG Intronic
No off target data available for this crispr