ID: 1074343406

View in Genome Browser
Species Human (GRCh38)
Location 10:112656607-112656629
Sequence TGGGAGGCCGAGGCAGATCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 792
Summary {0: 1, 1: 1, 2: 9, 3: 116, 4: 665}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074343406_1074343409 -5 Left 1074343406 10:112656607-112656629 CCTTGATCTGCCTCGGCCTCCCA 0: 1
1: 1
2: 9
3: 116
4: 665
Right 1074343409 10:112656625-112656647 TCCCAAAGTGCTGAGATTATAGG 0: 1974
1: 46781
2: 334557
3: 242573
4: 130485

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074343406 Original CRISPR TGGGAGGCCGAGGCAGATCA AGG (reversed) Intronic
900096301 1:941494-941516 AGGGAGGCTGAGGCCCATCAGGG + Intronic
900223336 1:1521051-1521073 TGGGAGGCAGAGGCAGAGGCGGG + Intronic
900275321 1:1822406-1822428 TGGGAGGCTGAGGCAGGGAATGG - Intronic
900529803 1:3147621-3147643 GGGGAGGCCAAGGCACATCTTGG + Intronic
900649668 1:3724546-3724568 TGGCAGGCCTAGGCAGGTGAGGG - Intronic
900983667 1:6060659-6060681 TGGGAGGCCCAGGCAGGTGGCGG + Intronic
901060410 1:6469293-6469315 TGGGTGGGCAAGGCAGATTAGGG - Intronic
901300540 1:8197119-8197141 TGGAGTGCCGTGGCAGATCATGG + Intergenic
901576532 1:10205579-10205601 TGGGAGGCCGAGGCCGAGGTGGG + Intergenic
901648981 1:10732635-10732657 TGGGATGCAGAGGCAGAGGAGGG + Intronic
901788030 1:11637510-11637532 AGGGAGGCCGAGGAAGTCCAGGG + Intergenic
901960419 1:12822251-12822273 TGGGAGGCCGAGGCAGCCTCGGG - Intergenic
902270635 1:15301919-15301941 TGGGAGGCCGAGGCTGAACCTGG + Intronic
902346344 1:15820863-15820885 TGGGAGGCTGAGGCAGAGAGGGG + Intergenic
902373921 1:16021398-16021420 ACGGAGGCCGAGGCAGAGCCAGG - Intronic
902389350 1:16093867-16093889 TGGGAGGGCCAGGCAGCTCCAGG - Intergenic
902718116 1:18286661-18286683 AGGGAGTCCCAGACAGATCAGGG + Intronic
902897140 1:19486335-19486357 TGGAAGGCCGAGGCGGGCCAAGG + Intergenic
903375410 1:22862808-22862830 TGGGAGCCCTAGACAGCTCACGG + Intronic
903393416 1:22981200-22981222 TGGGAGGCTGAGGCAGGTGGAGG + Intergenic
903412992 1:23161919-23161941 TGGGAGGCTGAGGCGGAGAACGG + Intronic
903477656 1:23630915-23630937 TGGGAGGCCAAGGCAGGCCTTGG + Intronic
903482413 1:23663490-23663512 TGGGAGGCTGAGGCAGGAGAAGG + Intergenic
903503250 1:23813920-23813942 TGGGAGACTGAGGCAGAGGATGG - Intronic
903938181 1:26911025-26911047 TTGAAGGCCAAGGCAGACCAAGG - Intronic
903981589 1:27192596-27192618 TGGGAGGCCGAGGCAGGTGGAGG - Intergenic
903990245 1:27262627-27262649 TGGGAGGCCAAGGAAGGCCAAGG - Intronic
904022805 1:27480772-27480794 TGGGAGGCCGAGGCGGGTGGAGG + Intronic
904188100 1:28721653-28721675 TGGGAGGCTGAGGCAGGAGAAGG + Intergenic
904212784 1:28896972-28896994 TGGGAGGAGGAGGCAGAGCTGGG + Intronic
904522055 1:31103125-31103147 TGGGAGGCTGAGGCTGAGCCTGG + Intergenic
904886371 1:33741778-33741800 TGGGAGGAGGAGGCAGCTGATGG - Intronic
905612338 1:39365179-39365201 TGGGAGGTTGAGGCAGAGAATGG - Intronic
905715960 1:40150095-40150117 TGGGAGGCTGAGGCAGAGGAAGG + Intergenic
906232471 1:44176454-44176476 TGGGAGGCTGAGGCAGGTAGAGG + Intergenic
907135294 1:52134794-52134816 TGGGAGGCCGAGGCAGGAGGTGG + Intergenic
908156593 1:61359682-61359704 CGGGAGGCTGAGGCAGAAGAAGG - Intronic
908166975 1:61468476-61468498 TGGGAGGCTGAGGCAGGAGAAGG - Intergenic
909650662 1:77972502-77972524 TGGGAGGCCGAGGCAGGGCGGGG + Intronic
910386523 1:86689358-86689380 TGGGAGGCTGAGGCAGGTGGAGG - Intergenic
910665519 1:89722138-89722160 TGGGAGGCTGAGGCGGAGAATGG + Intronic
910673123 1:89793098-89793120 TGCGAGGCCGAGGCCGAGAAGGG + Intronic
910868390 1:91808710-91808732 TGGGAGGCTGAGGCAGAGGCAGG - Intronic
910965177 1:92801089-92801111 TGGGAGGCTGAGGCAGGAGAAGG + Intergenic
911031836 1:93497063-93497085 TGGGAGGCTGAGGCAGGGAATGG - Intronic
911636051 1:100237565-100237587 TGGGTGGCAGAGGCAAAACAAGG + Intronic
911891014 1:103371891-103371913 TGGGAGGCTGAGGCAGGAAATGG + Intergenic
912851315 1:113127668-113127690 TGGGAGGCTGAGGCAGAAGAAGG - Exonic
914222506 1:145693526-145693548 TGGGAGGCCGAGGCCGAGGCAGG + Intronic
914222751 1:145695172-145695194 TGGGAGGCAGAGGCAGAGGTGGG + Intronic
914341824 1:146766439-146766461 TGGGAGGCAGAGGCAGAGCCAGG - Intergenic
914490542 1:148148118-148148140 GGGGAGGCCGAGGCAGAGCTGGG + Intronic
914710775 1:150211670-150211692 TGGGAGGCTGAGGCAGGAGACGG + Intergenic
915076053 1:153308785-153308807 TGGAAGGCAGAGGCAGGCCAAGG - Intronic
915179273 1:154043858-154043880 TGGGAGGCCGAGGCAGACTTGGG - Intronic
915590476 1:156867571-156867593 TGGGAGGCCGAGGCGGAGGATGG - Intronic
915594882 1:156891117-156891139 TGGGAGGCCGAGGCAGGCAGAGG - Intergenic
915958825 1:160246739-160246761 TGGGAGGCCGAGGCAGGAGTTGG + Intronic
916083687 1:161252958-161252980 TGGGACCCCGACTCAGATCATGG + Intergenic
916689869 1:167179983-167180005 TGGGAGGCCGAGGCAGCCAGAGG + Intergenic
917356691 1:174133072-174133094 TGGGAGGCTGAGGCAAAAGATGG + Intergenic
917939731 1:179906841-179906863 CGGGAGGCTGAGGCAGAAGAAGG - Intronic
918071595 1:181137382-181137404 TGGGAGGCCGAGGCGGTCAAGGG - Intergenic
919403415 1:197147580-197147602 TGGGAGGCCGAGGCGGAGGCAGG - Intergenic
919710754 1:200725588-200725610 TGGGAGGCTGAGGCAGGAGAAGG + Intergenic
919794684 1:201314210-201314232 TGGGAGGCCGAGGCAGGAGCGGG + Intronic
919902173 1:202052169-202052191 CGGGAGGCTGAGGCAGAGAATGG + Intergenic
919952134 1:202374782-202374804 TGGGAGGCGGAGGCAGAGGCGGG - Intronic
920200269 1:204255922-204255944 AGGGAGGCCTAGGCAGACCTAGG - Intronic
920411081 1:205761527-205761549 TGGGAGGCCAAGACAGAGGATGG - Intergenic
920591822 1:207227063-207227085 TGGGAGGACAAGGCAGGTAAAGG - Intergenic
921284242 1:213594794-213594816 TGGGAGGGCCAGGCAGAGCCAGG + Intergenic
921669728 1:217912430-217912452 TGGGAGGCTGAGGCAGGAAATGG + Intergenic
923239751 1:232071704-232071726 AGGGAGGCTGAGGCAGAGAATGG - Intergenic
923403258 1:233636290-233636312 TGGGAGGCTGGGGCCGATCAGGG + Intronic
923475950 1:234331133-234331155 TGGGAGGCCAAGGAAGGTCCAGG + Intergenic
923579976 1:235200212-235200234 TGGGAGGCCGAGGCAGAGGTGGG + Intronic
924465135 1:244292689-244292711 GGGGAGGCAGAGGCAGAAGATGG + Intergenic
924496360 1:244594078-244594100 TGGGAGGCTGAGGCAGAGGATGG + Intronic
924520335 1:244800888-244800910 TGGGAGGCTGAGGCAGAGGTGGG - Intergenic
924700061 1:246442314-246442336 TGGGAGGCCGAGGCAGGCTGAGG + Intronic
1063341423 10:5267730-5267752 TGGGAGGCTGAGGCAGGAGAAGG + Intergenic
1063411418 10:5839562-5839584 TAGGAGGCCGAGGAGGGTCAGGG - Intronic
1063445995 10:6117760-6117782 GGGGAGGCTGAGGCGGATCACGG - Intergenic
1063833622 10:9986377-9986399 CGGGAGGCTGAGGCAGAGAATGG - Intergenic
1064053360 10:12077475-12077497 TGGGAGGCCAAGGCGGGCCAAGG - Intronic
1065147801 10:22789210-22789232 TGGGAGGCTGAGGCAGGAGAAGG - Intergenic
1065235991 10:23653009-23653031 TGGGAGGCCAAAGCAGAGCGTGG + Intergenic
1065909611 10:30290493-30290515 TGGGAGCTGGAGGCAGATTATGG + Intergenic
1066405167 10:35111496-35111518 TGGGAGACCAAGGCAGAGGATGG - Intergenic
1066466614 10:35656350-35656372 TTGGAGGAAGAGGAAGATCAAGG - Intergenic
1066564709 10:36709260-36709282 TGGGAGGCTGAGGCAGGAGAAGG + Intergenic
1067808008 10:49406549-49406571 TGGGAGGCTGAGGCAGGCCCAGG + Intergenic
1068389043 10:56369217-56369239 TGGGAGGCTGAGGCAGGAGAAGG + Intergenic
1068921203 10:62486259-62486281 TGGCAGGCAAAGGCAGAACAAGG - Intronic
1069005719 10:63315596-63315618 TGGGAGGCCGAGGCAGCGGGCGG + Intronic
1069137321 10:64782276-64782298 TGGGACCCCGACTCAGATCATGG - Intergenic
1069655478 10:70084846-70084868 TGGGAGGCAGAGGCAGAGGCAGG - Intronic
1069980305 10:72247884-72247906 TGGGAGGCTGAGGCAGACGGAGG - Intergenic
1070818951 10:79343610-79343632 GGGGAGGCAGAGGCAGAGAAGGG - Intergenic
1070944172 10:80374948-80374970 TGGGAGGCTGAGGCAGAGAATGG + Intergenic
1071703172 10:87964436-87964458 TGGGAGGCTGAGGTTGATCCTGG + Intronic
1071706486 10:88004990-88005012 TGGGAGGCCGAGGCTGAGGTGGG + Intergenic
1073421306 10:103425783-103425805 TGGGAGGCTGAGGCAGGAGAAGG - Intronic
1073502697 10:103955738-103955760 CGGGAGGCTGAGGCAGAGAATGG + Intergenic
1074076237 10:110128519-110128541 TGGGAGGCTGAGGCAGAGAATGG - Intronic
1074343406 10:112656607-112656629 TGGGAGGCCGAGGCAGATCAAGG - Intronic
1075375454 10:121974927-121974949 TTGGAGGCGGAGGCCGACCAAGG - Exonic
1075607962 10:123829402-123829424 TGGGAGGCCGAGGCAATAGAGGG - Intronic
1076018834 10:127053234-127053256 TGGGAGGCTGAGGCAGGAGAAGG + Intronic
1076356787 10:129858946-129858968 TAGGAGGCCGTGGCAGATTTTGG - Intronic
1076412843 10:130264145-130264167 AGGGAGGCAGAGGCAAGTCAAGG - Intergenic
1076618652 10:131772927-131772949 TGGCAGGGCCAGGCAGGTCATGG - Intergenic
1076766463 10:132637161-132637183 TGGGAGGCCGAGGCAGCGGGCGG - Intronic
1077003955 11:342004-342026 TGGGAGGCTGAGGCAGGTTGAGG - Intergenic
1077233410 11:1468705-1468727 TGGGAGGCAGAGACAGGGCAGGG + Intergenic
1077599399 11:3563461-3563483 TGGGAGGCCGAGGTGGATGGAGG + Intergenic
1078363916 11:10691509-10691531 TGGGAGGCTGAGGAGGCTCATGG - Intronic
1078384829 11:10880317-10880339 TGGGAGGCCGAGGCGGGTTGCGG + Intergenic
1078780684 11:14436372-14436394 GGGGAGGGAGAGGCAGAACAGGG - Intergenic
1080177180 11:29379248-29379270 TGGGAGGCTGAGGCAGGAGAAGG - Intergenic
1080760385 11:35243435-35243457 TGGGAGGCCAAAGCAGGTGAAGG + Intergenic
1080867265 11:36206484-36206506 TGGGAGGCAGAGGCAGAGCGTGG + Intronic
1081808095 11:45900873-45900895 GGGGAGGCCGTGGGAGATCGTGG + Intronic
1082024576 11:47562951-47562973 TGGGAGGCGGAGGCAGAGGCAGG - Intronic
1084255305 11:67938066-67938088 TGGGAGGCCGAGGTGGATGGAGG + Intergenic
1084579383 11:70013530-70013552 TGGGAGGCCAAGGCAGAGGCAGG + Intergenic
1084817445 11:71657229-71657251 TGGGAGGCCGAGGTGGATGGAGG - Intergenic
1085111372 11:73892762-73892784 CGGGAGGCTGAGGCAGAGAATGG - Intronic
1085207271 11:74743383-74743405 TGGGAGGCCGAGGCAGGTGGAGG + Intergenic
1085357679 11:75854014-75854036 TGGGAGGCTGAGGCAGGTGTGGG - Intronic
1085542972 11:77289479-77289501 TGGGAGGCCGAGGCAGGGGGTGG + Intronic
1086488254 11:87331773-87331795 TGGGAGGCTGAGGCAGGAGATGG + Intergenic
1086773524 11:90799459-90799481 TGGGAGGCCAAGGCAGTTGGTGG + Intergenic
1087425873 11:97984944-97984966 TGGGAGGCTGAGGCAGAGAAAGG - Intergenic
1088194086 11:107256912-107256934 TGGGAGGCCGAGGCGGGGCAAGG + Intergenic
1088330612 11:108647367-108647389 TGGGGGGAGGAGGCAGAGCAAGG + Intergenic
1088509281 11:110558145-110558167 TGGGAGGTAGAGGCAGATAATGG - Intergenic
1088912114 11:114199475-114199497 TGGGAGGCCGGGGAAGGGCAAGG - Intronic
1089035191 11:115381948-115381970 TGGGAGGCTGAGGCAGGAGATGG - Intronic
1089430488 11:118419988-118420010 TGGGAGGCCGAGGCAGGCAGAGG + Intronic
1090154708 11:124425271-124425293 TGGGAGACGGAGGCAGAGAATGG - Intergenic
1090841095 11:130487886-130487908 TGGGAGCTAGAGGGAGATCAGGG - Intergenic
1091544013 12:1488444-1488466 TGGGAGGCCGAGGCAGAGGCGGG + Intronic
1091721159 12:2815080-2815102 TGGGAGGCCGAGGCAGGCCAAGG - Intronic
1092425539 12:8372806-8372828 TGGGAGGCCGAGGTGGATGGAGG + Intergenic
1093327424 12:17794981-17795003 TGGGAGGCTGAGGCAGAGAATGG + Intergenic
1093811379 12:23496473-23496495 TGGGAGGCTGAGGCAGAGAATGG - Intergenic
1094571986 12:31649055-31649077 TGGGAGGCTGAGGCAGAGGTTGG - Intronic
1094626590 12:32130307-32130329 TGGGAGGCTGAGGCAGGAGAAGG - Intronic
1094838859 12:34334687-34334709 GGGGAGGTCGAGGCAGAGCAGGG + Intergenic
1095402880 12:41835204-41835226 TGGGAGGCCGAGGCAGGTGGAGG + Intergenic
1095468432 12:42511974-42511996 GGGGAGTCAGATGCAGATCACGG - Intronic
1096188020 12:49595877-49595899 CGGGAGGCTGAGGCAGAAAATGG + Intronic
1096760922 12:53841277-53841299 TGGGAGGCCAAGGCAGGAGAAGG + Intergenic
1096773100 12:53949073-53949095 TGGGAGGCCCAGGCAGCCAAGGG + Intergenic
1097682049 12:62658124-62658146 TGGGAGGCCAAGGCAGAGGCAGG + Intronic
1098114224 12:67157243-67157265 TGGGAGGCTGAGCCAGATAATGG + Intergenic
1098340376 12:69444880-69444902 TGGGAGGCTGAGGCAGGAGAAGG - Intergenic
1099870771 12:88346714-88346736 TGGGAGGCCGAGGCAGGTGAAGG - Intergenic
1100501118 12:95174820-95174842 CGGGAGGCTGAGGCAGAGAATGG + Intronic
1100992364 12:100265353-100265375 TGGGAGGCTGAGGCAGGTGGAGG + Intronic
1101684670 12:107006882-107006904 TGGGAGGCCGAGGTAGATGGAGG - Intronic
1102290937 12:111699123-111699145 TGGGAGGCAGAGGCAGAGGTGGG - Intronic
1102589373 12:113945926-113945948 TAAGAGGCAGAGGCAGAACAGGG + Intronic
1102842724 12:116143266-116143288 AGGGAGGCCGAGGCAGGGCAGGG + Intronic
1103246078 12:119458653-119458675 AGGGAGGCCGATTCAGGTCATGG + Intronic
1103296592 12:119892255-119892277 TGGGAGGCCGAGGCAGGTGGAGG - Intergenic
1103983995 12:124755144-124755166 TGGGAGGCCCAGGCAGGGCTGGG - Intergenic
1104101037 12:125609709-125609731 TGGGAGGCTGAGGCAGGAGAAGG + Intronic
1104281705 12:127383843-127383865 TGGGAGGCTGAGGCAGAGAATGG - Intergenic
1104850559 12:131871504-131871526 AGGGAGGCCGAGGCAGGAGAAGG + Intergenic
1105060716 12:133147881-133147903 TGGGAGGCCAAGGCAGGCCTCGG - Intronic
1105474156 13:20716883-20716905 TGGGAGGGTGAGCCACATCAAGG + Intronic
1107109817 13:36684648-36684670 TGGGATGCAGAGACACATCATGG - Intronic
1107324671 13:39228886-39228908 TGGGAGGCCAAGGCGGAGAATGG - Intergenic
1108247560 13:48532983-48533005 TGGGAGGCCGAGGGGGATCGCGG - Intronic
1109428411 13:62199087-62199109 TGGGAGGCAGAGGCAGAGGCAGG - Intergenic
1110264560 13:73522839-73522861 TGGGAGGCTGGGGCAGATGCTGG - Intergenic
1111057060 13:82964839-82964861 TGGGAGGCTGAGGCAGAAGGAGG + Intergenic
1111157006 13:84340951-84340973 TGGGAGGAGGAAGAAGATCAAGG - Intergenic
1112328537 13:98459882-98459904 TGGGAGGGAGAGGCTGAGCAGGG + Intronic
1112359471 13:98704578-98704600 TGGGAAGCTGAGGCAAATAAAGG - Intronic
1112695633 13:101945073-101945095 TGGGAGGCCGAGGCAGCAGGTGG + Intronic
1113200619 13:107865461-107865483 TGGGAGTCCTTGGAAGATCAGGG - Intronic
1113824916 13:113244733-113244755 TGGGAGGCTGAGGCAGAGAATGG + Intronic
1114203051 14:20540875-20540897 TGGGAGGCTGAGGCAGGAGAAGG + Intergenic
1114288099 14:21264786-21264808 TGGGAGGCCAGGGTAGAGCACGG + Intronic
1114330097 14:21628008-21628030 TGGGATGGTGAGGCAGATGAGGG + Intergenic
1114501687 14:23174103-23174125 TGGCATGCCGATGCAAATCATGG + Intronic
1114529569 14:23387477-23387499 TGGGAGACAGCGGCAGAACAGGG + Intronic
1114908894 14:27167181-27167203 TGGGAGGCTGAGGCAGGAGAAGG - Intergenic
1115189212 14:30728998-30729020 TGGGAGGCCAAGGTGGATGATGG - Intronic
1115864749 14:37732721-37732743 CGGGAGGCTGAGGCAGAGAATGG - Intronic
1116175865 14:41469593-41469615 TGGGAGGCTGAGGCAGAGAATGG + Intergenic
1116261176 14:42629410-42629432 TGGGAGGACGAAGAAAATCAGGG - Intergenic
1116320213 14:43453365-43453387 AGGGAAGCAGAGGCAAATCATGG - Intergenic
1116414270 14:44661743-44661765 TGGGAGGCTGAGGCAGGAGATGG + Intergenic
1116708196 14:48330396-48330418 CGGGAGGCTGAGGCAGAAGAAGG + Intergenic
1116751192 14:48886677-48886699 TGGGAGGCCGAGGCGGGCCGAGG - Intergenic
1117122631 14:52584714-52584736 TGGGAGGCTGAGGCAGAGGATGG - Intronic
1117349035 14:54862693-54862715 TGGGAGGCCAAGGCAGGTGGTGG - Intronic
1117683446 14:58228782-58228804 CAGGAGGCTGAGGCAGAGCAGGG - Intronic
1118267440 14:64308252-64308274 TGGGAGGCCGAGGCAGGTGATGG - Intronic
1118637260 14:67759137-67759159 TGGGAGGCTGAGGCAGGAGAAGG + Intronic
1118655239 14:67940315-67940337 TGGGAGGCCAAGGCAGGTGGTGG - Intronic
1119739001 14:77001665-77001687 TGGGAGACCGAGGCAGCCGAGGG + Intergenic
1120906493 14:89625414-89625436 AGGGAGGCCGAGGGAGACAAAGG - Intergenic
1121015074 14:90544119-90544141 TGGGAGGAAGAGGCAGTTTAGGG + Intronic
1121984864 14:98495484-98495506 TGGGAGACCAAGGCAGAGGATGG + Intergenic
1121990998 14:98557177-98557199 TGGGAGGCCCAGGCAGACCCAGG - Intergenic
1122236844 14:100335623-100335645 TGGGAGGCCGAGGCAGGTGGGGG - Intronic
1122717541 14:103704650-103704672 TGGGAGGCCGAGGCTGAGGCAGG - Intronic
1123015571 14:105372665-105372687 TGGGAGGCCGAGGCAGTACGAGG + Intronic
1202881276 14_KI270722v1_random:62492-62514 TGGGAGGCCGAGGAGGAGAATGG + Intergenic
1123668367 15:22628465-22628487 TGGGAGGCCGAGGCAGGAGTTGG - Intergenic
1123709333 15:22975512-22975534 TGGGAGGCAGAGGCAGAGGCGGG + Intronic
1123752080 15:23364449-23364471 TGGGAGGCCAGGGCACAGCAGGG + Intronic
1124357836 15:29010362-29010384 TGGGAGGCTGAGGCAGGAGAAGG - Intronic
1124754065 15:32393445-32393467 TGGGAGGCCAGGGCACAGCAGGG - Intronic
1124899800 15:33811397-33811419 TGGGAGGCTGAGGCAGAGGCAGG + Intronic
1124938729 15:34197989-34198011 TGGGAGGCCGAGGCAGCGAATGG - Intronic
1125299049 15:38234920-38234942 CGGGAGGCTGAGGCAGAGAATGG - Intergenic
1126313672 15:47344512-47344534 AGGGAGACCAAGGAAGATCATGG + Intronic
1126646293 15:50877922-50877944 TGGGAGGCTGAGGCAGAGGCAGG + Intergenic
1126890655 15:53200838-53200860 TGGGAGGCTGAGGCAGGAGAGGG + Intergenic
1127119349 15:55757867-55757889 TGGGAGGCTGAGGCAGGAGAAGG + Intergenic
1127469995 15:59282309-59282331 TGGGAGGTCTAGACAGAGCAGGG - Intronic
1127489638 15:59450168-59450190 TGGGAGGCCGAGGCGGCAGATGG - Intronic
1127491744 15:59471676-59471698 TGGGAGGCAGAGGCAGAGGCTGG - Intronic
1127966087 15:63923924-63923946 TGGGAGGCCGAGGCAGCAGAAGG - Intronic
1128077012 15:64833515-64833537 TGGGAGGTCAAGGCAGGTCAAGG + Intergenic
1128391932 15:67188241-67188263 TGGGAGGCTGAGGCACGTCCTGG - Intronic
1128803753 15:70515060-70515082 TGGGATCCAGAGGCAGATCCTGG - Intergenic
1129075458 15:72991903-72991925 TGGGAGGCCGAGGCAGCGGGCGG + Intergenic
1129473461 15:75767637-75767659 TGGGAGGCAGAGGTTGAACAGGG + Intergenic
1129513878 15:76144684-76144706 AGGGAGGGAGAGGCAGATGATGG - Intronic
1129814982 15:78543807-78543829 TGGGAGGCCGAGGTAGATGGAGG - Intronic
1129992684 15:79978442-79978464 GGGGAGGCTGAGTCAGAGCATGG - Intergenic
1130545721 15:84856788-84856810 AGGAAGGCCCAGGCAGATAAGGG + Exonic
1130849473 15:87779330-87779352 TGGGAGGCCGAGGCAGGAGTTGG + Intergenic
1132371159 15:101300141-101300163 TGGGAGGCCGAGGCAGGGACAGG - Intronic
1132807577 16:1782218-1782240 AGGGAGGCCGGGGCGGATCGCGG + Intronic
1132896641 16:2232428-2232450 GGGGAGGGCGTGGCAGCTCAGGG - Intronic
1133206470 16:4237180-4237202 TGGGAGGCGGAGGCAGAGGCAGG - Intronic
1133213473 16:4275991-4276013 TGGGTGGCCCAGGCAGACCCGGG + Intergenic
1133287898 16:4698959-4698981 TGGGACGCTGAGGCATATCCTGG - Intronic
1133355615 16:5134572-5134594 TGGGAGGCTGAGGCAGAGAATGG - Intergenic
1133626807 16:7577655-7577677 TGGGAGGCAGAGGCAGAGGCAGG + Intronic
1133773154 16:8879472-8879494 TGGGAGGCTGAGGCAGGAGAAGG - Intergenic
1134113671 16:11532153-11532175 TGGGAGGCTGAGGCAGGTGTAGG - Intergenic
1134274477 16:12763309-12763331 TGGGAGGCTGAGGCAGGCCTCGG - Intronic
1134775674 16:16851239-16851261 TGGGAGACCAAGGCTGATGATGG - Intergenic
1135030824 16:19037153-19037175 TGGGAGGCCGAGGCAGGTCAGGG + Intronic
1135077012 16:19402474-19402496 TGGGAGGCTGAGGCAGGGGAAGG - Intergenic
1135177635 16:20244974-20244996 TGGGAGTCTGAGGCAGAGAATGG + Intergenic
1135421903 16:22310693-22310715 TGGGAGGCCGAGGCAGGCCCAGG + Intronic
1135870324 16:26143859-26143881 TGGGAGGCTGAGGCAGGAGAAGG - Intergenic
1135876929 16:26210650-26210672 TGGGAGGCAGAGGCAGAGGCAGG - Intergenic
1135894820 16:26389715-26389737 TGGGAGGCCGAGGCAGGAGGAGG - Intergenic
1136133304 16:28238534-28238556 TGGGAGGCCGAGGCTGGAGATGG + Intergenic
1136542333 16:30935063-30935085 TGAGAGGCCGTGGGAGATCAAGG + Intronic
1137748785 16:50842661-50842683 TGGGAGGCAGAGGCAGGTTCCGG - Intergenic
1138004024 16:53313702-53313724 TGGGAGGCCGAGGCCGAGGCCGG + Intronic
1138479634 16:57293713-57293735 TGGGAGGCGGAGGCCAATGATGG + Intergenic
1138892786 16:61165421-61165443 TGGGAGGCCGAGGCAGGTTGAGG + Intergenic
1139516639 16:67456235-67456257 TGGGAGGCTGAGGCAGGTGGAGG - Intronic
1139992452 16:70950986-70951008 TGGGAGGCAGAGGCAGAGCCAGG + Intronic
1140096044 16:71876443-71876465 TGGGAGGCCGAGGCAGGAGGTGG - Intronic
1140286129 16:73604638-73604660 TGGGAGGCTGAGGCAGAGAATGG + Intergenic
1140342321 16:74176558-74176580 TGGGAGGCCAAGGCAGGCCAAGG + Intergenic
1141140231 16:81492646-81492668 TGGGAGGAGGAGGCAAAACAGGG + Intronic
1141451784 16:84108505-84108527 TGGGAGGCTGAGGCAGGTGCTGG - Intronic
1142700574 17:1657720-1657742 TGGGAGGCAGAGGCAGAGGCAGG + Intronic
1142752123 17:1995173-1995195 TGGGAGGCCAAGGGAGGCCAAGG + Intronic
1142872926 17:2832734-2832756 TGGGAGGCCGAGGCGGGCGATGG + Intronic
1143077762 17:4359628-4359650 TGGGAGGCCAAGGCAGGCCAAGG + Intronic
1143096905 17:4483080-4483102 TGGGGGGCAGAGGCTGAGCAGGG - Intronic
1143194029 17:5061573-5061595 CGGGAGGCTGAGGCAGAGAATGG + Intergenic
1143835842 17:9691935-9691957 CAGGAGGCCGAGGCAGAGAATGG + Intronic
1144155789 17:12499982-12500004 TGGGAGGCCAAGGCAGGACCTGG + Intergenic
1144690859 17:17262622-17262644 TGGGAGGCTGAGGCAGGAGAAGG + Intronic
1144902655 17:18611722-18611744 CGGGAGGCTGAGGCAGAGAATGG - Intergenic
1144928407 17:18834257-18834279 GGGGAGGCTGAGGCAGAGAATGG + Intergenic
1145082113 17:19902709-19902731 AGGGAGGCTGAGGCAGAGGAAGG - Intergenic
1145129910 17:20335030-20335052 CGGGAGGCTGAGGCAGAGAATGG + Intergenic
1145281088 17:21467593-21467615 TGGGAGGCTGTGGCAGCTCAGGG - Intergenic
1145396863 17:22503313-22503335 TGGGAGGCTGTGGCAGCTCAGGG + Intergenic
1146127116 17:30238451-30238473 TGGGAGGCCGAGGAAGGACAAGG - Intergenic
1146137758 17:30338096-30338118 TGGGAGGCTGAGGTAGAGAATGG - Intergenic
1146331513 17:31931459-31931481 TGGGAGGCCGAGGCCGAGGCAGG - Intergenic
1146570178 17:33945734-33945756 TGGGGAGCTGAGTCAGATCACGG - Intronic
1146727053 17:35164978-35165000 TGGGAGGCTGAGGCAGAGGCAGG - Intronic
1147004369 17:37390043-37390065 TGGGAGGCAGAGGCAGAGGCAGG + Intronic
1147123381 17:38349700-38349722 GGGGAGGCCAAGGCAGGTCTTGG - Intergenic
1147231660 17:39023804-39023826 TGGGAGGCTGAGGCAGGTGGAGG - Intergenic
1147274936 17:39308095-39308117 TGGGAGGCCAAGGCAGGTGGAGG + Intronic
1147418672 17:40311259-40311281 TGGGAGGCCGGGGCAGTGCCAGG - Intronic
1147710166 17:42458039-42458061 TGGGAGGCCGAGGCGGGTGGAGG + Intergenic
1147759699 17:42789414-42789436 TGGGAGGCCGAGGCCGAGGCAGG + Intronic
1147780760 17:42940114-42940136 TGGGAGGCTGAGGCAGGAGAAGG - Intergenic
1148224209 17:45887150-45887172 TGGGAGGCTGAGGCAGGGCCTGG - Intergenic
1148368838 17:47078318-47078340 TGGGAGGCCGAGGCATGGGAGGG - Intergenic
1148374822 17:47133682-47133704 TGGGAGGCCGAGGCCGAGGCGGG - Intronic
1148375314 17:47139370-47139392 TGGGAGGCTGAGGCAGGAGAAGG - Intronic
1148493866 17:48040311-48040333 TGGGAGGCCGAGGCAGGAGGAGG - Intergenic
1148502852 17:48104886-48104908 TGGGAGGCCGAGACAGGTCAAGG - Intronic
1148734044 17:49854619-49854641 TGCCTGGCTGAGGCAGATCATGG + Intergenic
1148745818 17:49917525-49917547 TGGGAGGCCGAGGCCGAGGTGGG - Intergenic
1148804380 17:50257048-50257070 TGGGAGGTGGAGGCAGCCCAGGG + Intergenic
1148936123 17:51165922-51165944 TGGGAGGCCGAGGCTTAACCAGG + Intronic
1149573378 17:57693416-57693438 TGGGAGGCAGAGGCAGAGGCAGG - Intergenic
1149771394 17:59324607-59324629 TGGGAGGCTGAGGCAGGTGGAGG + Intergenic
1150327112 17:64266044-64266066 TGGGAGGCCGAGGCTGAGGTGGG - Intergenic
1150601918 17:66658373-66658395 TGGGAGGCTGAGGCAGAGGCAGG + Intronic
1150708614 17:67510540-67510562 TGGGAGGCCGAGGCGGTCAAGGG - Intronic
1150839913 17:68598243-68598265 TGGGAGGCAGAGGCAGAGGGAGG - Intronic
1151191742 17:72403612-72403634 TGGGAGTCCATGCCAGATCATGG - Intergenic
1151313113 17:73306247-73306269 TGGGAGGCAGAGGCAGAAGCAGG + Intronic
1151314496 17:73313084-73313106 TGGGAGGCCAAGGCAGGTGGGGG + Intergenic
1151363451 17:73602319-73602341 TGCGAGGCCTGGGCAGAGCAAGG + Intronic
1151457275 17:74233509-74233531 TGGGCGGCAGAGGCAGATGGGGG + Intronic
1151717400 17:75838114-75838136 TGGGAGGCGGAGGGAGCCCAGGG - Intronic
1151864321 17:76790313-76790335 TATGAGGCCGAGGCCGAGCATGG - Intergenic
1152919301 17:83057918-83057940 AGGGAGGCCGAGGCAGAGCGGGG - Intergenic
1153233135 18:2959920-2959942 TGGGAGGCCGAGGCCGAAGCCGG + Intronic
1153294358 18:3531586-3531608 CGGGAGGCTGAGGCAGAGAATGG - Intronic
1153600479 18:6776535-6776557 TGGGAGGCCAAGGCAGAGGCAGG - Intronic
1153976382 18:10271750-10271772 GGAGAGGCTGAGGCAAATCATGG + Intergenic
1154374568 18:13798402-13798424 CGGGAGGCTGAGGCAGAACCTGG + Intergenic
1154947388 18:21175772-21175794 TGGGAGGCTGAGGCAGGAGAAGG + Intergenic
1155464009 18:26115409-26115431 TGGGAGGCTGAGGCAGGAGAAGG + Intergenic
1155549671 18:26951886-26951908 TGGGAGCCAGAGGAAGATCTTGG + Intronic
1155629431 18:27874865-27874887 TGGGAGGCCGAGGCTGAGGTGGG + Intergenic
1156255754 18:35394794-35394816 TGGGAGGCCGAGGCGGGTGGTGG + Intergenic
1157422879 18:47560742-47560764 TGGGAGGGTGAGGCAGAGCCAGG + Intergenic
1157961234 18:52155425-52155447 TGGGAGGCTGAGGCAGGTGGTGG - Intergenic
1158227018 18:55211866-55211888 CGGGAGGCTGAGGCAGAGAATGG - Intergenic
1159782344 18:72674871-72674893 TGGGAGGCTGGGGCAGACCTGGG - Intergenic
1159812892 18:73037770-73037792 TGGGAGACCGAGGCAGGTTAAGG - Intergenic
1159930583 18:74309250-74309272 TGGATTGCCGAGGCAGAACAAGG + Intergenic
1160340274 18:78083556-78083578 TGGGAAGCCGAGGCAGGTAGTGG - Intergenic
1160759286 19:774904-774926 TGGGAGGCTGAGGCAGGAGATGG - Intergenic
1160940668 19:1619123-1619145 CGGGAGGCCGAGACAGGTCAGGG + Exonic
1161793692 19:6374903-6374925 AGGGAGGGAGCGGCAGATCACGG - Exonic
1161969666 19:7570476-7570498 TGGGAGGCTGAGGCAGGAGAAGG - Intergenic
1162010148 19:7808338-7808360 TGGGAGGCCAAAACAGATTAGGG + Intergenic
1162049628 19:8025103-8025125 TGGGAGGCTGAGGCGGAGAATGG - Intronic
1162268833 19:9597670-9597692 TAGGAGGCCAAGGCTGAGCATGG - Intergenic
1162537312 19:11270772-11270794 TGGGAGGCTGAGGCAGGAGAAGG - Intergenic
1162833040 19:13298865-13298887 TGGGAGGGCGAGGCCGAGCGAGG - Exonic
1162889291 19:13720831-13720853 TGGGAGGCTGAGGCAGGACTGGG - Intergenic
1162945917 19:14043527-14043549 TGGGAGGCTGAGGCAGAGAATGG - Intronic
1163047406 19:14654366-14654388 TGGGAGGCTGAGGGAGAGGATGG - Intronic
1163204595 19:15793504-15793526 TGGGAGGCGGAGGCAGAGGGGGG - Intergenic
1163892972 19:20033159-20033181 TGGGAGGCTGAGGCAGAGGCAGG + Intronic
1163948589 19:20563589-20563611 TGGGAGGCTGAGGCACAAGAAGG - Intronic
1164101298 19:22056579-22056601 CGGGAGGCCGAGGCAGGAGAAGG - Intronic
1164833356 19:31340084-31340106 GGGGAGGGCGAGGCGGCTCATGG - Intronic
1165047934 19:33120882-33120904 GGGGAGGCTGAGGCAGAAGAAGG + Intronic
1165400620 19:35597391-35597413 TGGGAGGCTGAGGCAGAACTCGG - Intergenic
1165539555 19:36480787-36480809 TGGGAGGCCAAGGCCCACCAAGG + Intronic
1166498402 19:43323230-43323252 TGGAAGGCCAAGGCAGAACAAGG + Intergenic
1166547193 19:43640432-43640454 CCGGAGGTCGAGGCAGGTCAAGG + Intergenic
1166565362 19:43762008-43762030 TGGGAGGCGGAGGCAGAGGCAGG + Intergenic
1166576952 19:43850665-43850687 TGGGAGGCTGAGGCAGGTGCAGG - Exonic
1166608822 19:44170354-44170376 TGGGAGGCCGAGGCAGGGGGTGG + Intronic
1166708907 19:44924823-44924845 TGGGAGGCTGAGGCAGGGGAAGG - Intergenic
1167054570 19:47101467-47101489 TGGGAGGCCAAGGCAGGAGAAGG - Intronic
1167075826 19:47248441-47248463 TGGGAGGCCGAGGCGGGTGTGGG - Intergenic
1167695030 19:51010137-51010159 TGGGAGGAGGAGACAGAACACGG + Intergenic
1167904187 19:52644772-52644794 TGGGAGGTCGAGGCAGGTGGAGG + Intronic
1168061813 19:53897349-53897371 TGGGGGGCCGAGGCAGGAAAAGG + Intronic
1168217494 19:54936970-54936992 TGGGAGGCCGAGGCCGAGGCGGG + Intronic
1168405756 19:56109469-56109491 GGGGAGGCTGAGGGAGATAAGGG - Intronic
1202656883 1_KI270708v1_random:31601-31623 TGGGAGGCCGAGGAGGAGAATGG + Intergenic
925511167 2:4626867-4626889 TGGGAGGCCGAGGCGGGTGGAGG - Intergenic
926234272 2:11027665-11027687 TGGGAGGCTGAGGCAGAGAATGG - Intergenic
926255842 2:11197188-11197210 GGGGATGCTGAGGCAGATGATGG - Exonic
926576160 2:14584355-14584377 TGGGAGGCCGAGGCGGGCCTCGG + Intergenic
927202586 2:20587638-20587660 CGGGAGGCCGAGGCAGGAGAAGG + Intronic
927238689 2:20901224-20901246 GGGGAGGCTGAGGCAGAGAATGG + Intergenic
927811099 2:26180542-26180564 TGTGGGGCCAAGGCAGATCCTGG - Intronic
928407808 2:31028332-31028354 TGGGAGGAGGAGGGAGATCTGGG - Intronic
928540640 2:32280482-32280504 CGGGAGGCTGAGGCAGAGAATGG - Intronic
929690718 2:44070513-44070535 TGGGAGGCAGAGGCAGGCAATGG + Intergenic
929942683 2:46346960-46346982 TGTGGGGCAGAGGCAGCTCATGG - Exonic
930077922 2:47422390-47422412 TGGGAGGCTGAGGCAGGCCAAGG - Intronic
930375371 2:50558974-50558996 TGGGAGGCTGAGGCAGGAGAAGG + Intronic
930720542 2:54633545-54633567 TTGGAGGTTGGGGCAGATCAGGG + Intronic
930772922 2:55145654-55145676 TGGGAGGCCAAGGCAGGCCAGGG + Intergenic
931858666 2:66330987-66331009 TGGGAGGCAGAGGCAGGTCGGGG + Intergenic
932232416 2:70093746-70093768 TGGGAGGCTGAGGCAGGAGAAGG + Intergenic
932333523 2:70915333-70915355 TGGGAGGCTGAGGCAGGGAAGGG - Intronic
932446733 2:71786191-71786213 TGGAAGGCAGAGGCAGAGTAGGG + Intergenic
932569252 2:72929368-72929390 AGGGAGGCTTAGGGAGATCATGG + Intronic
932864007 2:75322660-75322682 TGGGAGGCCGAGGCAGGCAGAGG + Intergenic
933186961 2:79289519-79289541 TGGGAGGCCGAGGCGGGTGTTGG + Intronic
933355555 2:81205913-81205935 TGGGAGGGCGAGCCAAAGCAGGG + Intergenic
933829838 2:86197933-86197955 TGGGAGGCTGAGGCGGAGAATGG + Intergenic
934729205 2:96646102-96646124 TGGGAGGCTGAGGCAGGAGAAGG - Intergenic
935363368 2:102266643-102266665 TGGGATGCTGAGGCAGCTCAGGG - Intergenic
935973570 2:108555416-108555438 TGAGAGGCAGAGGGAGATCCAGG - Intronic
936789815 2:116138378-116138400 TGGTAGGCCGAGGCAGGTGGGGG + Intergenic
937137078 2:119562909-119562931 TAGGAGGCCGAGGCAGAGGATGG + Intronic
937314980 2:120926294-120926316 TGGGAGGCCGAGGCAGATGGAGG + Intronic
937511999 2:122606339-122606361 TGAAAGGCCGATGCAGTTCAAGG + Intergenic
939218870 2:139276363-139276385 TGGGAGGCTGAGGCAGGAGAAGG + Intergenic
939560128 2:143721931-143721953 TGGGAGGCCGAGGCCGAGGCCGG - Intronic
940732330 2:157407293-157407315 TGGGAGGCTGAGGCAGAGAATGG - Intergenic
940866532 2:158823193-158823215 CGGGAGGCTGAGGCAGAGAATGG - Intronic
941145676 2:161841316-161841338 TGGGAGGCTGAGGCAGGTAGAGG - Intronic
941503971 2:166316587-166316609 CGGGAGGCTGAGGCAGAGAATGG + Intronic
941891451 2:170585950-170585972 TGGGAGGCTGAGGCAGGCCAGGG + Intronic
941952522 2:171171258-171171280 TGGGAGGCCAAGGCAGGTGGAGG + Intronic
942298322 2:174538227-174538249 TGGGAAGTCAAGGCAGCTCATGG - Intergenic
943128993 2:183833701-183833723 TGGGTGGCAGAGGCAGAGTAGGG - Intergenic
944673575 2:202016355-202016377 TGGGAGGCTGAGGCAGGAAATGG + Intergenic
945232384 2:207606232-207606254 TGGGAGGCCGAGGCAGAGGAGGG + Intronic
945483569 2:210369200-210369222 TGGGAGGCTGAGGCAGGAGAAGG - Intergenic
946234539 2:218315395-218315417 TGGGAGGCCGAGGCGGGTGGAGG - Intronic
946356933 2:219192653-219192675 TGGGAGGCCGAGGCAGGTGGAGG - Intergenic
946827595 2:223694877-223694899 TGGGAGGCAGAGGCAGAAATGGG + Intergenic
947147134 2:227078473-227078495 TGGGAGGCTGAGGCAGGTGGAGG - Intronic
947415479 2:229891035-229891057 TGGGAGGCCAAGGCACAAGAAGG + Intronic
947510334 2:230747111-230747133 GGGGAGGCCGAGGCAGGTGCAGG + Intronic
947542920 2:230991012-230991034 GGGGCGGCCGGGGCAGAACACGG - Intergenic
947706573 2:232281291-232281313 TGGGAGGCTGAGGCAGGAGAAGG + Intronic
948298269 2:236880905-236880927 TGGGAGGCTGAGGCAGGAGAAGG + Intergenic
948413528 2:237783202-237783224 CGGGAGGCTGAGGCAGAGAATGG + Intronic
948577359 2:238963528-238963550 TTGGAGGCCAAGTCAGACCAGGG + Intergenic
949014473 2:241701813-241701835 TCGGAGGCCGAGGAGGAGCAGGG - Intergenic
1169373625 20:5047912-5047934 TGGGAGGCTGAGGCAGCGCAAGG + Intergenic
1169460634 20:5791322-5791344 TGGGAGGCTGAGGCAGTAGATGG + Intronic
1169863835 20:10178915-10178937 TGGGAGGCAGAAGCAGGACATGG + Intergenic
1170084958 20:12519964-12519986 TGGGAGGCTGAGGCAGAAGAAGG + Intergenic
1170589283 20:17759177-17759199 TGGGAGGCTGAGGCAGGAGACGG - Intergenic
1171040935 20:21763053-21763075 CGGAAGGCCCAGGCATATCACGG - Intergenic
1171447101 20:25212612-25212634 TGGGAGGCTGAGGCAGGAAATGG + Intronic
1171954534 20:31450463-31450485 TGGGAGGCTGAGGCAGGAGAAGG - Intergenic
1172156685 20:32830827-32830849 TGGGAGGCTGAGGCAGAGAATGG - Intronic
1172290237 20:33770738-33770760 TGGGAGGCCAAGGCAGAAGGAGG + Intronic
1172480975 20:35271202-35271224 CGGTAGGCCGAGGGAGGTCAGGG + Intronic
1172598028 20:36163947-36163969 AGGGAGGCTGAGGCAGACCTGGG - Intronic
1172660996 20:36568698-36568720 CGGGAGGCCGAGGCAGGGGAAGG - Intergenic
1172772398 20:37389286-37389308 TGGGAGGAAGGGGCAGTTCAGGG - Intronic
1172911625 20:38413734-38413756 TGGGAGGCCGAGGCAGGCTGAGG + Intergenic
1174142170 20:48423100-48423122 TGGGAGGCCGAGGCAGGCGATGG - Intergenic
1174242201 20:49146025-49146047 TGGGAGGCCGAGGCAGGTGGTGG + Intronic
1174601862 20:51731475-51731497 TGGGAGGCCGAGGCAGGCGGAGG + Intronic
1174722744 20:52831194-52831216 TGGGAGGCTGAGGCAGCGGAAGG - Intergenic
1175086030 20:56459707-56459729 TGGGAGGCCGAGGCGGGGGATGG - Intronic
1175246420 20:57584973-57584995 GGGGTGGCCCAGGCAGGTCAGGG + Intergenic
1175319107 20:58073024-58073046 GGGGAGACTGAGGCAGCTCAGGG - Intergenic
1175411253 20:58770919-58770941 TGGGAGGCGGGGGCTGAGCAAGG + Intergenic
1175576728 20:60066009-60066031 TGGGAGACAGAGGCAGCTCAGGG - Intronic
1175985792 20:62763659-62763681 TGGGAGGCAGAGCCTGAGCAAGG + Intergenic
1176277284 20:64279621-64279643 AGGGTGCCCCAGGCAGATCACGG + Intronic
1176677015 21:9788359-9788381 TGGGAGACTGAGCTAGATCAGGG - Intergenic
1176814388 21:13583484-13583506 TGGGAGGCTGAGGCAGCGGATGG + Intergenic
1177076153 21:16575794-16575816 CGGGAGGCTGAGGCAGAACCCGG + Intergenic
1178385996 21:32151108-32151130 TGGGAGGCAGAGGCCGGGCACGG + Intergenic
1178493907 21:33071141-33071163 TGGGAGAGCGAGGCCGAGCAAGG + Exonic
1180684430 22:17654341-17654363 TGGGAGGCGGAGGCAGAGGCAGG - Intronic
1180969128 22:19805870-19805892 TGGGCTTCCGAGGCAGCTCAGGG + Intronic
1181121135 22:20669241-20669263 GGGGAGGCCGAGGCAGAGCTGGG - Intergenic
1181334097 22:22116267-22116289 AGGGAGGCCGAGGCAGAGCTGGG - Intergenic
1181358999 22:22320793-22320815 TGGGAGGCTGAGGCAGGAGAAGG - Intergenic
1181476698 22:23172596-23172618 TGGGAGGCTGAGGCAGGAAATGG + Intergenic
1181693821 22:24582955-24582977 TGGGAGGCCGAGGCGGGTGGAGG - Intronic
1181709197 22:24670649-24670671 TGGGAGGCTGAGGCAGAGCTCGG + Intergenic
1182405984 22:30130835-30130857 TGGGAGGCGGAGGCAGAGGCGGG - Intronic
1182590193 22:31373344-31373366 TGGGAGGCCGAGGCAGGTGGCGG + Intergenic
1182609548 22:31535622-31535644 TGGGAGGCTGAGGCAGAGGCAGG - Intronic
1182788472 22:32928222-32928244 TGGGAGGCTGGGGCAGGTGAAGG + Intronic
1183620860 22:38971632-38971654 TGGGAGGACGAGGCTGGGCATGG + Intronic
1183673010 22:39283828-39283850 TGGGAGCCCCAGGCAGGGCAGGG + Intergenic
1183869326 22:40729335-40729357 TGGGAGGCCGAGGCCGAGGCGGG - Intergenic
1183941568 22:41298603-41298625 TGGGAGGCCGAGGCCGGGCGTGG - Intergenic
1184289392 22:43490326-43490348 AGGGAGGCCCAGGCAGAGCTGGG - Intronic
1184533630 22:45071903-45071925 TGGGGGGCGGAGGCAGGGCAGGG + Intergenic
1184584960 22:45441726-45441748 TGGGAGGCTGAGGCAGAGGCAGG - Intergenic
1185346251 22:50312087-50312109 TGGGAGGCTCAGGCAGACCTAGG + Exonic
1185397338 22:50599915-50599937 TGGGAGGAGGCGGGAGATCAGGG - Intronic
949177786 3:1087133-1087155 TAGGAGGCAGAAGTAGATCAGGG + Intergenic
950022398 3:9796833-9796855 TGGGAGGCTGAGGCAGGAGAAGG + Intronic
950081040 3:10222337-10222359 TGGCAAGCTGAGGCTGATCAGGG + Intronic
950123285 3:10495908-10495930 TGGGAGGCGGAGGCAGCCCCAGG - Intronic
950165956 3:10799132-10799154 GGGCAGGGCGAGGCAGGTCAGGG - Intergenic
950449852 3:13059370-13059392 GGGGAGGCCGAGGCAGCTGCTGG - Intronic
950593182 3:13954087-13954109 TGGGAGGCTGAGGCAGGAGAAGG - Intronic
950751227 3:15129677-15129699 TGGGAGGCCGAGGTGGATGGAGG - Intergenic
950959057 3:17085553-17085575 TGGGAGGCTGAGGCAGAGAATGG - Intronic
953117721 3:40009480-40009502 TGGGAGGCCGAGGCCGAGGCGGG - Intronic
953628239 3:44588597-44588619 TGGGAGGCTGAGGGAGGTCGAGG - Intronic
953730583 3:45444108-45444130 TGGGAGGCTGAGGCAGGAGAAGG - Intronic
954033368 3:47836376-47836398 TGGGAGGCGGAGGCAGAGGCAGG - Intronic
954166246 3:48760579-48760601 TGGGAGGCCGAGGCTGAGGTGGG + Intronic
954365383 3:50143369-50143391 TGGGAGGCTGAGGCAGAGGCAGG - Intergenic
954389415 3:50260870-50260892 TGGGAGGCCGGGGCAGGTGGAGG - Intergenic
954721657 3:52569314-52569336 TGGGAGGCTGAGGCAGGAGAAGG - Intronic
954822357 3:53341347-53341369 TGGGAGGCCGAGCCAGGAGAAGG + Intronic
955160541 3:56461404-56461426 TGAAAGGCCCAGGCAGATGAAGG + Intronic
955919810 3:63943761-63943783 TGTGAGGCTGAGGCAGAGGAAGG - Intronic
956221888 3:66913138-66913160 CGGGAGGCCGAGGCAGGGAACGG + Intergenic
956633426 3:71338656-71338678 TGGGAGGCCGAGGCGGGTTCAGG - Intronic
956665681 3:71639904-71639926 TGGGAGGCCGAGGAGGGTGAAGG - Intergenic
956794300 3:72704085-72704107 TGGGTGGCCCAGGGAGTTCACGG + Intergenic
956816754 3:72914943-72914965 TGGGAGGCCAAGGCAGGCTAAGG + Intronic
956865262 3:73363040-73363062 TGGGAGGTCAAGGGAGGTCAAGG + Intergenic
957070223 3:75562093-75562115 TGCGAGGCTGAGGCAGATGGAGG + Intergenic
958195698 3:90239501-90239523 TGGGAGGCTGAGGCACAAGAAGG + Intergenic
958538110 3:95430772-95430794 CGGGAGGCCGAGGCAGGAGAAGG + Intergenic
958723794 3:97878303-97878325 GGGGAGGCTGAGGCAGAGAATGG + Intronic
959982803 3:112536497-112536519 TGGGAGGTGGTGGCAGATGAGGG + Exonic
960049725 3:113228250-113228272 TGGGGGGACGGGGCAGATGATGG + Intronic
960774042 3:121228634-121228656 TGGGAGGCTGAGGCAGTGGATGG + Intronic
961283867 3:125784424-125784446 TGGGAGGCCGAGGTGGATGGAGG - Intergenic
961720264 3:128889925-128889947 CGGGAGGCTGAGGCAGAGGATGG - Intronic
962305310 3:134280941-134280963 TGGGAGGCCGAGGCTGAAGCGGG + Intergenic
963143597 3:141969505-141969527 TGGGAGGCTGAGGCAGAGAATGG + Intronic
963267081 3:143250282-143250304 TGGGAGGCTGAGGCAGAAGAAGG + Intergenic
963948284 3:151170378-151170400 CGGGAGGCTGAGGCAGAGAATGG - Intronic
964972921 3:162583258-162583280 TGGGAGGCCGGGGCAGAGAATGG + Intergenic
965508582 3:169543332-169543354 TGGGAGGCCGAGGCAGAGGACGG + Intronic
966166885 3:177029569-177029591 TGGAATGCAGTGGCAGATCAAGG - Intronic
966252104 3:177877697-177877719 TGGGAGGCTGAGGCAGGAGAAGG - Intergenic
966282617 3:178250491-178250513 GAGTAGGCCGAGGAAGATCAGGG + Intergenic
966426723 3:179787832-179787854 TGGGAGGCTGAGGCAGGTTGAGG - Exonic
966537358 3:181049679-181049701 TGGGAGGCCGAAGCAGACGGAGG + Intergenic
966619207 3:181945906-181945928 TGGGTTGCCTAGGCATATCAGGG - Intergenic
966626682 3:182024507-182024529 TGGGAGGCCAAGGAAGATTTCGG + Intergenic
966698719 3:182821212-182821234 TGGGAGGCTGAGGCAGAGAATGG - Intronic
966793344 3:183692771-183692793 TGGGAGGCCGAGGCCGAGGCAGG + Intergenic
967365961 3:188686720-188686742 TGGGAAGCCGAGGGAGGCCATGG + Intronic
967369931 3:188732515-188732537 TGGGAGGCCGAGGCGGGTCACGG + Intronic
968286734 3:197513253-197513275 CGGGAAGCCGAGGCGGATCTGGG + Intronic
969456324 4:7301758-7301780 TGGGAGGCCAGCGCAGCTCATGG - Intronic
969551111 4:7867845-7867867 TGGCAGGCCCAGGCAGAGCGGGG + Intronic
969573212 4:8022266-8022288 GTGGGGGCTGAGGCAGATCAGGG - Intronic
969799313 4:9550167-9550189 TGGGAGGCCGAGGTGGATGGAGG - Intergenic
970191448 4:13522916-13522938 TGGGAGGCCGAGAGAGGTCCCGG + Intergenic
970318372 4:14851439-14851461 TGGGAGGCCGAGGCAGGTTGAGG - Intergenic
970405783 4:15761957-15761979 TGGGAGGCCGAGACAGGCCGAGG + Intergenic
971913529 4:32827988-32828010 TGGGAGGCCGAGGCCGAGGCAGG - Intergenic
973893515 4:55390894-55390916 TGGGAGGCTGAGGCAGGAGATGG - Intergenic
974545993 4:63307395-63307417 TGGGAGGCTGAGGCAGAGAATGG + Intergenic
974761760 4:66285504-66285526 TGGGAAGCAGCGGCAGGTCAGGG - Intergenic
976619799 4:87115855-87115877 TGGGAGGCAGAGGCAGAGGCGGG - Intronic
977209760 4:94205738-94205760 TGGGAGGCCAAGGCAGAGCTGGG - Intergenic
978114987 4:105008821-105008843 TGGGAGGCTGAGGCAGGAGAAGG - Intergenic
978448187 4:108801110-108801132 TGGGAGGCCGAGGCGGGTGGAGG - Intergenic
978802063 4:112764580-112764602 TGGGAGGCCGAGGCCGAGGTGGG - Intergenic
979067269 4:116153682-116153704 TGGGAGGCTGAGACAGAGAATGG + Intergenic
980342767 4:131571895-131571917 TGGGAGGCCAAGGCAGGTCTCGG + Intergenic
980924448 4:139120686-139120708 TGGGAGGCAGAGGCAGAGGTGGG - Intronic
981051773 4:140316268-140316290 TGGGAGGCTGGGTCAGATCGGGG + Intronic
981780476 4:148423812-148423834 TGGGAGGCTGAGGCAGGGGAAGG - Intronic
982168458 4:152638018-152638040 TGGGAGGCCAAGGCAGCAGAAGG + Intronic
982962157 4:161853516-161853538 TGGGAGGCCGAGGGAGGCCGAGG - Intronic
985212636 4:187611753-187611775 TGGGAGGCCGAGGCAGGCGGAGG - Intergenic
985396179 4:189546860-189546882 TGGGAGGCTGAGGCAGAGAATGG - Intergenic
985398529 4:189570425-189570447 TGGGAGACTGAGCTAGATCAGGG + Intergenic
985658915 5:1146042-1146064 TGGGAGACGGAGGCAGAACGGGG - Intergenic
986592557 5:9386547-9386569 TGGGAGGACTAGACAGATGAGGG - Intronic
986608990 5:9547873-9547895 TGGGAGGAAGAGGCAGGCCAAGG + Intergenic
987142896 5:14963337-14963359 TGGGAGGCTGAGGCAGGAGAAGG - Intergenic
988042791 5:25910545-25910567 GGGGAGGCTGAAGCAGATCGAGG + Intergenic
988088075 5:26497158-26497180 TGGGAGGCTGAGACAGAGAATGG + Intergenic
988681240 5:33486163-33486185 CAGGAGGCTGAGGCAGTTCAAGG - Intergenic
989219265 5:38937137-38937159 AGGGAGGCCGAGGCAGGGAATGG - Intronic
989241672 5:39209567-39209589 TGGGAGGCTGAGGCAGGTGGTGG - Intronic
989627497 5:43444378-43444400 CGGGAGGCTGAGGCAGACAATGG - Exonic
990362527 5:55035146-55035168 CGGGAGGCTGAGGCAGAGAATGG + Intergenic
991042262 5:62188248-62188270 TGGGAGGCCAAGGCAGGAGATGG - Intergenic
991333166 5:65515306-65515328 TGGGAGGCTGAGGCGGAGGATGG - Intergenic
991349293 5:65703930-65703952 TGGGAGGCTGAGGCAGGAGAAGG + Intronic
991370956 5:65919401-65919423 CGGGAGGCTGAGGCAGAGAATGG - Intergenic
991443258 5:66673726-66673748 TGGGAGGCCGAGGCAGGCAGAGG - Intronic
993260010 5:85646063-85646085 TGGGAGGCAGAGGCAGAGGCAGG + Intergenic
993614709 5:90097286-90097308 TGGGAGGCCGAGGAAGCTGGTGG + Intergenic
993731310 5:91426476-91426498 TGGGAGGCCAAGGGAGGCCAAGG + Intergenic
995640317 5:114249390-114249412 TGGGAGGCTGAGGCAGGAGATGG - Intergenic
995805996 5:116053102-116053124 TGGGAGCCCAAGGCAGATGGTGG + Intronic
995864599 5:116677823-116677845 TGGGAGGCCAAGGCAGGTGGGGG - Intergenic
996482546 5:123991094-123991116 TGGGAGGCTGAGGCAGAGAATGG + Intergenic
997584114 5:135034501-135034523 TGTGAGGCCGAGGGAGAACTCGG - Intronic
997927671 5:138045756-138045778 TGGGAGGCTGAGGCAGGTGGAGG + Intronic
998194893 5:140060170-140060192 TGGGAGGCTGAGGCAGAACCTGG - Intergenic
998790151 5:145757719-145757741 TGGGAGGCAGAGGCAGAGGCAGG + Intronic
998847371 5:146324031-146324053 TGGGAGGCTGAGGCAGGAGAAGG + Intronic
999094340 5:148964795-148964817 TGGGAGGCTGAGGCAGGAGAAGG + Intronic
999583745 5:153067778-153067800 TTGGAGGCCCAGACAGATAAGGG + Intergenic
1000120303 5:158191222-158191244 TGGGAGGCTGAGGCAGAGAATGG - Intergenic
1000304063 5:159979962-159979984 AGGAAGCCAGAGGCAGATCAAGG + Intergenic
1000987029 5:167872051-167872073 TGGGAGGCTGAGGCAGGTGGAGG + Intronic
1001129977 5:169055724-169055746 CGGGAGGCTGAGGCAGAGAATGG + Intronic
1001154047 5:169257656-169257678 TGGGAGGCTGAGGCAGGAGAAGG - Intronic
1001727033 5:173912692-173912714 TGGGAGGCTGAGGTAGAGGATGG + Intronic
1001913130 5:175537381-175537403 TGGGAGGCTGAGGCAGAGGATGG + Intergenic
1001914645 5:175549441-175549463 TGGGAGGCCGAAGCAGAGGCTGG + Intergenic
1002201204 5:177529507-177529529 TGGCAGGCCCAGGCAGAACCAGG - Intronic
1002390261 5:178905993-178906015 TGGGAGGCCAAGGCAGGTGGCGG - Intronic
1002687632 5:181026471-181026493 TGGGAGGCTGAGGCAGGAGAAGG + Intergenic
1002691894 5:181055661-181055683 TGGGAGGCTGAGGCAGGAGAAGG + Intronic
1002876472 6:1215355-1215377 TGGGAGGCAGAGGCACAGGACGG + Intergenic
1003889125 6:10548325-10548347 TGGGAGGCCCAGGAATATCTTGG - Intronic
1005473119 6:26181810-26181832 TGGGAGGCTGAAGGAGATCCCGG - Intergenic
1005826789 6:29636977-29636999 TGGGAGGCAGAGGCATTTGAGGG + Intergenic
1006227254 6:32549275-32549297 TGGGAGGCTGAGGCAGAGAATGG - Intergenic
1006359288 6:33578608-33578630 TGGGAGTACGAGGCAGGTTATGG - Intronic
1006607301 6:35267335-35267357 TGGGAGACCGAGGCAGGTGGAGG - Intronic
1007045398 6:38768503-38768525 TGGGAGGCCAAGGCAGATGATGG - Intronic
1007358563 6:41339488-41339510 TGGGAGGCTGAGGCAGGAGAAGG - Intronic
1007479015 6:42137797-42137819 TGGGAGGCCGAGGCAGGGGCGGG + Intronic
1007547088 6:42702621-42702643 TGGGAGGCCGAGGCCGAGGCTGG + Intronic
1008058994 6:46976919-46976941 AGGTAGGCCCAGGGAGATCAAGG + Intergenic
1008251888 6:49250365-49250387 TGGGAGGCCAAGGCAGGGCCAGG + Intergenic
1008661555 6:53673164-53673186 GGGGAGAGCCAGGCAGATCAGGG - Intergenic
1008775960 6:55038463-55038485 TGGGAGGCTGAGGCGGAGAATGG - Intergenic
1010245278 6:73656504-73656526 TGGGAGGCTGAGGCAGGTGGAGG - Intergenic
1010419949 6:75661806-75661828 TGGCAGGCCGAGGCAGGTGGTGG + Intronic
1011451820 6:87500988-87501010 TGGGAGGCCGAGGCGGGTGGTGG - Intronic
1011935760 6:92775765-92775787 TGGGAGGCTGAGGCAGGAGAAGG - Intergenic
1012033062 6:94097817-94097839 TGGGAGGCTGAGGCAGGAGAAGG + Intergenic
1013236207 6:108199330-108199352 TGGGAGGCTGCGGCAGCTCTGGG + Intergenic
1013879097 6:114872327-114872349 TGGGAGGCCCAGGCTGGTCCAGG - Intergenic
1013905110 6:115206914-115206936 TGGGAGGCTGAGGCAGGAGAAGG + Intergenic
1014550243 6:122781990-122782012 TGGGAGGCCGAGGCAGCAGGCGG - Intronic
1014929062 6:127311431-127311453 TGGGAGGCAGAGGCAGGCCCTGG + Intronic
1015504472 6:133968090-133968112 GGGGAGGCTGAGGCAGATGCAGG - Intronic
1016482081 6:144493727-144493749 TGGGAGGCTGAGTCAGGTAATGG + Intronic
1016533084 6:145079832-145079854 TGGGAGGCCAAGGCAGGTGGAGG - Intergenic
1017022526 6:150152012-150152034 TGGGAGGCTGAGGCAGGAGAAGG + Intronic
1017138776 6:151171689-151171711 TGGGAGGCGGAGGCTGAGGAGGG - Intergenic
1017138852 6:151172105-151172127 TGGGAGGCGGAGGCTGAGGAGGG - Intergenic
1017283326 6:152646728-152646750 TGGGAGGCTGAGGTAGAGAATGG - Intergenic
1018057657 6:160066391-160066413 TGGGAGGCCAAGGCAGACGGAGG - Intronic
1018402883 6:163443460-163443482 TGGGAGACTGAGGCAGATAATGG + Intronic
1018417864 6:163616967-163616989 TGGGAGTCAGGAGCAGATCAAGG - Intergenic
1018774179 6:166998747-166998769 TCGGAGGCCGTGGCCGAGCAGGG + Intergenic
1019547844 7:1587042-1587064 TGGGAGGCCGCAGGAGAACAGGG - Intergenic
1019724174 7:2591915-2591937 TGGGAGGCCGAGGCAGGCCCGGG - Intronic
1019724189 7:2591970-2591992 TGGGAGGCCGAGGCAGGCCCGGG - Intronic
1019724204 7:2592025-2592047 TGGGAGGCCGAGGCAGGCCCGGG - Intronic
1019761665 7:2817351-2817373 TGGGAGGCCGAGGCAGGGGTGGG - Intronic
1019868513 7:3736396-3736418 TGGGAGGCTGAGGCAGGAGAAGG - Intronic
1020081283 7:5287183-5287205 TGGGAGGCCGAGGCAGGAGTTGG + Intronic
1020153915 7:5705975-5705997 TGGGAGGCCGAAGCAGGTGGAGG + Intronic
1020508079 7:9018768-9018790 TGGGACGCAGAAGCAGAACATGG + Intergenic
1020829931 7:13082167-13082189 CGGGAGGCTGAGGCAGAAGAAGG + Intergenic
1021722458 7:23517371-23517393 TGGGAGGCTGAGGCAGGAAATGG + Intronic
1022168308 7:27795789-27795811 TGGGAGGCCAAGGCGGGTCGAGG - Intronic
1022312570 7:29210935-29210957 AGGGAGGAGGAGGCGGATCATGG + Intronic
1023268241 7:38431548-38431570 TGGGAGGCTGAGGCAGGAGAAGG + Intronic
1023809438 7:43900689-43900711 TGGGAGCCTGAGGCAGAAGATGG - Intronic
1024047265 7:45593197-45593219 AGGGAGGACGAGGCAGGTCCTGG + Intronic
1024879869 7:54072601-54072623 CGGGAGGCTGAGGCAGGTGAAGG + Intergenic
1025197629 7:56944992-56945014 TGGGAGGCCGAGGCAGGACTTGG - Intergenic
1025220805 7:57105984-57106006 TGGGAGGCTGAGGCAGCAGAAGG + Intergenic
1025631619 7:63277796-63277818 TGGGAGGCTGAGGCAGCAGAAGG + Intergenic
1025674317 7:63631946-63631968 TGGGAGGCCGAGGCAGGACTTGG + Intergenic
1025920252 7:65905413-65905435 TGGGAGGCTGAGGCAGGAAATGG - Intronic
1025981774 7:66413017-66413039 TGGGAGGCCGAGGGGGAGGATGG - Intronic
1025993553 7:66513692-66513714 TGGGAGGCCCAGGCAGGAGATGG - Intergenic
1026034862 7:66823738-66823760 TGGGAGGCCCAGGCAGGAGATGG + Intergenic
1026090263 7:67293726-67293748 TGGGAGGCCAAGGCAGGTGGAGG - Intergenic
1026211288 7:68307941-68307963 TGGGAGGCTGAGGCAGAGAATGG - Intergenic
1026333298 7:69372190-69372212 TGGGAGGCTGAGGCAGAAGAGGG + Intergenic
1026626569 7:71998063-71998085 TGGGAGGCTGAGGCAGGTGGAGG - Intronic
1026825009 7:73576180-73576202 TGGGAGGCTGAGGCAGCTGCTGG + Intronic
1026857846 7:73766735-73766757 TGGGAGGCCGAGGCGTGGCAGGG - Intergenic
1027119857 7:75509040-75509062 TGGGAGGCCAAGGCAGGTGGAGG - Intergenic
1027214887 7:76177382-76177404 TGGGAGGCCCAGGCAGGAGATGG - Intergenic
1027271969 7:76526569-76526591 TGGGAGGCCAAGGCAGGTGGAGG + Intergenic
1027347427 7:77275707-77275729 TAGGAGGCCCAGGAAAATCATGG - Intronic
1028123496 7:87084612-87084634 TGGGATGCCTAGACAGAACAGGG + Intergenic
1029072490 7:97911396-97911418 TGGGAGGCCGAGGTGGATGGAGG + Intergenic
1029185280 7:98733970-98733992 TGGGAGGCCGAGGCAGGTGGAGG - Intergenic
1029268634 7:99362435-99362457 TGGGAGGCTGAGGCAGGAGAAGG - Intronic
1029717643 7:102340984-102341006 TGGGAGGCCAAGGCAGGTGGAGG + Intergenic
1029993878 7:104987428-104987450 TGGGAGGCTGAGGCAGGAGAAGG - Intergenic
1031961974 7:127998340-127998362 AGGGAGACCCAGGCAGGTCAGGG - Intronic
1032348430 7:131138169-131138191 TGGGAGGCAGAGGCAGAGGTGGG - Intronic
1033133738 7:138767780-138767802 AGGTAGGCAGAGCCAGATCATGG - Intronic
1033207995 7:139438932-139438954 TGGGAGGCCGAGGCGGGGCGGGG - Intergenic
1033423145 7:141220199-141220221 TGGGAGGCTGAGGCAGAGGCAGG + Intronic
1033533577 7:142290497-142290519 CGGGAGGCTGAGGCGGAGCATGG + Intergenic
1034184537 7:149164299-149164321 TGGGAGGCTGAGGCAGGAGAAGG + Intronic
1034402345 7:150871108-150871130 TGGGAGGCTGAGGCAGAGAATGG + Intergenic
1035068274 7:156123381-156123403 TGGGAGGCGGAGGGAGATGGCGG - Intergenic
1035737248 8:1897900-1897922 TGAGAGGCCGAGGCACAGCCAGG + Intronic
1035972808 8:4270384-4270406 AGTGTGGCCGAGGGAGATCATGG - Intronic
1036822151 8:11949933-11949955 TGGGAGGGGGATGCAGCTCACGG + Intergenic
1036889059 8:12583421-12583443 TGGGAGGCCGAGGTGGATGGAGG + Intergenic
1036896642 8:12641565-12641587 TGGGAGGCCGAGGTGGATGGAGG + Intergenic
1037548200 8:19944079-19944101 CGGGAGGCTGAGGCAGAGAATGG + Intronic
1037579871 8:20238799-20238821 TTGGAGGCCCAGCCAGATGAAGG + Intergenic
1037700328 8:21267884-21267906 TGGGAATCCGGGGGAGATCAAGG + Intergenic
1037856717 8:22376637-22376659 TGGGAGGCCGAGGCAGGCAAAGG + Intronic
1037924788 8:22835635-22835657 TGGGAGGCTGTGGAAGATCCTGG - Intronic
1038010958 8:23475451-23475473 TGGGAGATCGAGTCAGATTAGGG - Intergenic
1038538565 8:28372545-28372567 CGGGAGGCCGAGGCAGAGGATGG + Intronic
1038801917 8:30757078-30757100 TGGGAGGCCGAGGCCGATGGAGG + Intronic
1040012041 8:42669668-42669690 TGGGAGGCTGAGGCAGGTGGAGG - Intergenic
1040441687 8:47449927-47449949 TGGGAGGCCGAGGCAGGCAGTGG + Intronic
1040502255 8:48015270-48015292 TGGGAGGCTGAGGTAGAGTATGG + Intronic
1041636646 8:60153073-60153095 TGGGAGGGTAAGGGAGATCAGGG + Intergenic
1041708167 8:60868595-60868617 TGGGAGGCAGAGGCAGAGGCAGG - Intergenic
1041720170 8:60968267-60968289 TGGGAGGCCGAGGCCGAGGCCGG + Intergenic
1042389373 8:68215638-68215660 TGGGAGGCTGAGGCAGGAGAAGG - Intronic
1042437333 8:68782815-68782837 TAGGAGGCAGAGGCAGAGGATGG + Intronic
1042871426 8:73403542-73403564 TGGGAGGAGGAAGAAGATCAAGG + Intergenic
1045036651 8:98181324-98181346 TGGGAGGCCAAGGCAGGTGCAGG + Intergenic
1046467366 8:114623550-114623572 TGAGAGGCCAAGGGAGATAAAGG - Intergenic
1047229132 8:122980949-122980971 AGGGAGGCAGAGGAAGAACAGGG + Intergenic
1047248087 8:123161320-123161342 TGGGAGAAGGAGGCAGATGAAGG - Intergenic
1047498973 8:125428125-125428147 TGGGAGGCCGGGCCAGACAAGGG - Intergenic
1049141909 8:140962674-140962696 CGGGAGGCTGAGGCAGAGAATGG + Intronic
1049736481 8:144209472-144209494 TGGGAGGCTGAGGCAGAGAATGG + Intronic
1050157885 9:2686902-2686924 TGGGAGGCAGAGGCAGCAGAAGG + Intergenic
1050529170 9:6573208-6573230 TGGGAGGCTGAGGCAGGTGGAGG + Intronic
1051136864 9:13932647-13932669 AGGGAGGATGAGGGAGATCAAGG + Intergenic
1051261153 9:15265998-15266020 TGGGATGCTGAGGCAGAAAAAGG + Intronic
1051403059 9:16704752-16704774 TGGGAGGCCGCTGCAGCTCATGG - Intronic
1051874596 9:21777954-21777976 TGGGAGATTGAGTCAGATCAAGG + Intergenic
1051881514 9:21844924-21844946 CGGGAGGCCGAGGCAGTGAATGG + Intronic
1051887341 9:21907304-21907326 TGGGAGGCCAAGGCAGGCCGAGG + Intronic
1052171253 9:25399883-25399905 TGGGAGGCTGAGGCGGAGAATGG + Intergenic
1052953300 9:34231447-34231469 TGGGAGGCCAAGGCAGGTGGAGG - Intronic
1053874050 9:42524879-42524901 TGGGAGGCCGAGGCAGGAGATGG - Intergenic
1054268284 9:62941877-62941899 TGGGAGGCCGAGGCAGGAGATGG + Intergenic
1054710954 9:68510255-68510277 TGGGAGGCTGAGGCAGGAGAAGG - Intronic
1055295692 9:74830841-74830863 TGGGAGGCCGAGGCCGAGGCCGG - Intronic
1055858006 9:80715612-80715634 TGGGAGGCCGAGTCAGGTGGAGG + Intergenic
1055941460 9:81654444-81654466 TGGGAGGCTGAGGCAGGAGAAGG - Intronic
1056053975 9:82801305-82801327 TGGGAGGCAGAGGCAGAGGCAGG + Intergenic
1056351561 9:85754294-85754316 TGGGAGGCTGAGGCAGAGAATGG - Intergenic
1056392801 9:86154740-86154762 TGGGACCCCGACTCAGATCATGG - Intergenic
1056965570 9:91160898-91160920 GGGGAGGGCGAGTCAGAGCAGGG + Intergenic
1057014963 9:91643149-91643171 TGGGAGGAGGAGGCAGAAGAAGG + Intronic
1057215757 9:93227738-93227760 CGGGAGGCTGAGGCAGAGGATGG - Intronic
1057248953 9:93484159-93484181 TGGGAGGCTGAGGCAGGAGAAGG - Intronic
1059311586 9:113392032-113392054 TGGGAGGCAGAAGCAGACCTAGG - Intronic
1059691395 9:116688397-116688419 TGGGAGACAGAGGGAGTTCAGGG + Intronic
1060154908 9:121312865-121312887 TGGGAGGTTGAGGCAGGTGATGG - Intronic
1060316507 9:122516407-122516429 TGGGAGGCTGAGGCAGGAGAAGG - Intergenic
1060586942 9:124792552-124792574 AGGGTGGCAGGGGCAGATCATGG + Intronic
1060724596 9:125998565-125998587 TGGGAGGTTGAGGCAGAAAAGGG + Intergenic
1060740797 9:126096434-126096456 TGGGAGGCCAGGGCAGGCCAGGG + Intergenic
1060980211 9:127787415-127787437 TGGGAGACAGAGCAAGATCATGG - Intronic
1061345153 9:130018017-130018039 TGGGAGGCTGAGGCAGGAGAAGG - Intronic
1062074680 9:134579397-134579419 TGGGAGGCTGAGGCAGAAGGAGG + Intergenic
1062125738 9:134861098-134861120 TGGGAGGCTGAGGCGGGTGAAGG + Intergenic
1062403619 9:136383232-136383254 TGGGAGGCCTGGGCAGACCTCGG + Exonic
1062428173 9:136515607-136515629 TGGGCGGCAGAGGCAGGTGAAGG + Exonic
1062562444 9:137147703-137147725 TGAGAGGCAGAGGGAGACCAAGG + Intronic
1185801337 X:3014027-3014049 TGGGAGGCTGAGGCAGAAGAAGG + Intronic
1186788144 X:12972274-12972296 TGGAAGGCTGAGGCAGAGAATGG + Intergenic
1187773045 X:22723628-22723650 TGGGAGGCTGAGGCAGGAGAAGG - Intergenic
1187916610 X:24158740-24158762 TGGGAGGCTGAGGCAGGAGAAGG - Intronic
1188193606 X:27202049-27202071 TGGTAGGCTGAGGCAGAGGATGG - Intergenic
1189308663 X:40005684-40005706 AGGGAGGCCGAGGCCGGCCAGGG - Intergenic
1189406889 X:40733341-40733363 TGGGAGGCTGAGGCAGGGGAGGG - Intronic
1189780035 X:44505407-44505429 TGGGAGGCTGAGGCAGGAGAAGG - Intergenic
1190007084 X:46750453-46750475 TGGGAGGCTGAGGCTGATGGAGG - Intronic
1190018714 X:46852100-46852122 TGGGAGGCTGAGGCGGAGAATGG + Intronic
1190333055 X:49247625-49247647 TGGGAGGCCCAGGCCAGTCAGGG - Intronic
1190584453 X:51924854-51924876 TGGGAGGCCAAGGCAGGTGATGG + Intergenic
1190811368 X:53887562-53887584 TGGGAGGCCGAGGAGGGTGATGG + Intergenic
1190874337 X:54449112-54449134 TGGGAGGCAGGGGCAGAGCTAGG - Intronic
1191819463 X:65287513-65287535 TGGGGGGCCGAGGCAGGTCTAGG + Intergenic
1191875827 X:65795302-65795324 TGGGAGGCCGAGGCGGGCCTAGG + Intergenic
1192623049 X:72699265-72699287 TGGGAGGCCGAGGCAGGTGGAGG + Intronic
1193148871 X:78104532-78104554 TTGGAGGGCGAGGCTGCTCACGG + Intronic
1194103691 X:89739482-89739504 TGGGAGTCTGAGGAAGATGATGG - Intergenic
1194717991 X:97308911-97308933 TGGGAGGCTGAGGCAGGAGATGG + Intronic
1195137182 X:101920283-101920305 TGGGAGGCAGAGGCAGAGGCAGG - Intronic
1197741021 X:129893997-129894019 CGGGAGGCTGAGGCAGAGAATGG + Intergenic
1197817885 X:130517206-130517228 GGGGCGGCTGAGGCATATCATGG + Intergenic
1198825625 X:140695326-140695348 TGAGAGGCCAAGGCAGATGGAGG - Intergenic
1199111605 X:143941636-143941658 TGGGAGGCTGAGGCAGAGAATGG + Intergenic
1200053251 X:153445714-153445736 GGAGAGGCAGAGGCAGCTCAGGG + Intronic
1200244160 X:154514024-154514046 TGAGAGGTCAAGGAAGATCAAGG - Intronic
1200403467 Y:2783949-2783971 TGGGAGGCTGAGGCAGGAGAGGG - Intergenic
1200470288 Y:3578312-3578334 TGGGAGGCCGAGGCCAAGGAGGG + Intergenic
1200874022 Y:8133990-8134012 TGGGAGGCTGAGGCAGGAGAAGG + Intergenic
1200957273 Y:8963135-8963157 TGGGAGGCTGAGGCAGAGAATGG - Intergenic
1201337353 Y:12895080-12895102 CGGGAGGCTGAGGCAGAGAATGG + Intergenic
1202245078 Y:22811775-22811797 TGGGAGGCTGAGGCAGGAGAAGG - Intergenic
1202398068 Y:24445521-24445543 TGGGAGGCTGAGGCAGGAGAAGG - Intergenic
1202472713 Y:25224565-25224587 TGGGAGGCTGAGGCAGGAGAAGG + Intergenic