ID: 1074347192

View in Genome Browser
Species Human (GRCh38)
Location 10:112698803-112698825
Sequence CTGACTTTCCAGAGGTTCGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074347188_1074347192 24 Left 1074347188 10:112698756-112698778 CCCTTTGTGCACTCATTGTTGAA 0: 1
1: 0
2: 0
3: 9
4: 184
Right 1074347192 10:112698803-112698825 CTGACTTTCCAGAGGTTCGTTGG No data
1074347189_1074347192 23 Left 1074347189 10:112698757-112698779 CCTTTGTGCACTCATTGTTGAAC 0: 1
1: 0
2: 0
3: 16
4: 318
Right 1074347192 10:112698803-112698825 CTGACTTTCCAGAGGTTCGTTGG No data
1074347187_1074347192 27 Left 1074347187 10:112698753-112698775 CCACCCTTTGTGCACTCATTGTT 0: 1
1: 0
2: 1
3: 22
4: 197
Right 1074347192 10:112698803-112698825 CTGACTTTCCAGAGGTTCGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074347192 Original CRISPR CTGACTTTCCAGAGGTTCGT TGG Intronic
No off target data available for this crispr