ID: 1074347192 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 10:112698803-112698825 |
| Sequence | CTGACTTTCCAGAGGTTCGT TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1074347188_1074347192 | 24 | Left | 1074347188 | 10:112698756-112698778 | CCCTTTGTGCACTCATTGTTGAA | 0: 1 1: 0 2: 0 3: 9 4: 184 |
||
| Right | 1074347192 | 10:112698803-112698825 | CTGACTTTCCAGAGGTTCGTTGG | No data | ||||
| 1074347189_1074347192 | 23 | Left | 1074347189 | 10:112698757-112698779 | CCTTTGTGCACTCATTGTTGAAC | 0: 1 1: 0 2: 0 3: 16 4: 318 |
||
| Right | 1074347192 | 10:112698803-112698825 | CTGACTTTCCAGAGGTTCGTTGG | No data | ||||
| 1074347187_1074347192 | 27 | Left | 1074347187 | 10:112698753-112698775 | CCACCCTTTGTGCACTCATTGTT | 0: 1 1: 0 2: 1 3: 22 4: 197 |
||
| Right | 1074347192 | 10:112698803-112698825 | CTGACTTTCCAGAGGTTCGTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1074347192 | Original CRISPR | CTGACTTTCCAGAGGTTCGT TGG | Intronic | ||
| No off target data available for this crispr | |||||